View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0914_low_65 (Length: 268)
Name: NF0914_low_65
Description: NF0914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0914_low_65 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 38 - 247
Target Start/End: Complemental strand, 25342758 - 25342549
Alignment:
Q |
38 |
acatatatgactccacttttctgaaacgattttggttatggaagtccctttctttagtccgtataattgtcggctaagaaactacacacactaaaaacag |
137 |
Q |
|
|
|||||||||||||||| ||||| ||| |||| |||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
T |
25342758 |
acatatatgactccacctttctaaaatgattctggttatggaagtccctttctttagtccgtattactgtcggctaagaaactacacacactaaaaacag |
25342659 |
T |
 |
Q |
138 |
gttcagtgtaaatccaatgaaaaccattaacatcccttactccaaaacaattgaacaacatgtgcatttattttatgtggtgaatgcatgcaccgtgcat |
237 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25342658 |
gttcagtgtaaatccaatgaaaaccattaacatcccttactccaaaacaattgaacaacatgtgcatttattttatgtggtgaatgcatgcaccgtgcat |
25342559 |
T |
 |
Q |
238 |
tttgttggag |
247 |
Q |
|
|
| |||||||| |
|
|
T |
25342558 |
tatgttggag |
25342549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University