View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0914_low_66 (Length: 268)
Name: NF0914_low_66
Description: NF0914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0914_low_66 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 40 - 208
Target Start/End: Complemental strand, 28751216 - 28751048
Alignment:
Q |
40 |
catcctttggtcacactctcctttttatggccaacacaggtaaggccaccatcagtttccatttatgaattctttctcttcaatgcattgatttttagca |
139 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28751216 |
catcctttggtcacactctcctttttatggccaacacaggtaaggccaccatcagtttccatttatgaattctttctcttcaatgcattgatttttagca |
28751117 |
T |
 |
Q |
140 |
cgtcaaatgtgaactttcatttccatttgtgattttgagtattgtttggtttcaaaattttattttaaa |
208 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28751116 |
cgtcaaatgtgaactttcatttccatttgtgattttgagtattgtttggtttcaaaattttattttaaa |
28751048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University