View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0914_low_68 (Length: 264)

Name: NF0914_low_68
Description: NF0914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0914_low_68
NF0914_low_68
[»] chr8 (1 HSPs)
chr8 (85-163)||(36170708-36170786)


Alignment Details
Target: chr8 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 85 - 163
Target Start/End: Complemental strand, 36170786 - 36170708
Alignment:
85 aaccttagtaaccatctttggagaatgtactcttaccttggaactctgctttggtttcctcctctgcagctctctgctc 163  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36170786 aaccttagtagccatctttggagaatgtactcttaccttggaactctgctttggtttcctcctctgcagctctctgctc 36170708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University