View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0914_low_69 (Length: 263)

Name: NF0914_low_69
Description: NF0914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0914_low_69
NF0914_low_69
[»] chr7 (2 HSPs)
chr7 (150-232)||(28838934-28839016)
chr7 (40-74)||(28838822-28838856)


Alignment Details
Target: chr7 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 150 - 232
Target Start/End: Original strand, 28838934 - 28839016
Alignment:
150 taccaatgaaaaattctgaaaaccaaaacaaatcacctgaagaaaataaaactgattcacctgataaccttccagagaatatt 232  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
28838934 taccaatgaaaaattctgaaaaccaaaacaaatcacctgaagaaaataaaaccgattcacctgataaccttccagagaatatt 28839016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 40 - 74
Target Start/End: Original strand, 28838822 - 28838856
Alignment:
40 cattttcgttttagtggtaacaccataaatcgaat 74  Q
    |||||||||||||||||||||||||||||||||||    
28838822 cattttcgttttagtggtaacaccataaatcgaat 28838856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University