View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0914_low_69 (Length: 263)
Name: NF0914_low_69
Description: NF0914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0914_low_69 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 150 - 232
Target Start/End: Original strand, 28838934 - 28839016
Alignment:
Q |
150 |
taccaatgaaaaattctgaaaaccaaaacaaatcacctgaagaaaataaaactgattcacctgataaccttccagagaatatt |
232 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
28838934 |
taccaatgaaaaattctgaaaaccaaaacaaatcacctgaagaaaataaaaccgattcacctgataaccttccagagaatatt |
28839016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 40 - 74
Target Start/End: Original strand, 28838822 - 28838856
Alignment:
Q |
40 |
cattttcgttttagtggtaacaccataaatcgaat |
74 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |
|
|
T |
28838822 |
cattttcgttttagtggtaacaccataaatcgaat |
28838856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 669 times since January 2019
Visitors: 6696