View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0914_low_70 (Length: 261)
Name: NF0914_low_70
Description: NF0914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0914_low_70 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 38 - 237
Target Start/End: Complemental strand, 25342758 - 25342559
Alignment:
| Q |
38 |
acatatatgactccacttttctgaaacgattttggttatggaagtccctttctttagtccgtataattgtcggctaagaaactacacacactaaaaacag |
137 |
Q |
| |
|
|||||||||||||||| ||||| ||| |||| |||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
25342758 |
acatatatgactccacctttctaaaatgattctggttatggaagtccctttctttagtccgtattactgtcggctaagaaactacacacactaaaaacag |
25342659 |
T |
|
| Q |
138 |
gttcagtgtaaatccaatgaaaaccattaacatcccttactccaaaacaattgaacaacatgtgcatttattttatgtggtgaatgcatgcaccgtgcat |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25342658 |
gttcagtgtaaatccaatgaaaaccattaacatcccttactccaaaacaattgaacaacatgtgcatttattttatgtggtgaatgcatgcaccgtgcat |
25342559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 264 times since January 2019
Visitors: 6702