View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0914_low_72 (Length: 261)
Name: NF0914_low_72
Description: NF0914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0914_low_72 |
 |  |
|
[»] scaffold0174 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 39 - 233
Target Start/End: Original strand, 24895007 - 24895201
Alignment:
Q |
39 |
atatcctcctccacgaccttcatatcctcctcttaccgaactatattcgtttcctcctccccaattgcctctatttctccctcttctagcttctctatgt |
138 |
Q |
|
|
||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
T |
24895007 |
atatcctcctccaggtccttcatatcctcctcttaccgaactatattcgtttcctcctccccaattgcctctatttctccctcttctagcttctctacgt |
24895106 |
T |
 |
Q |
139 |
tttcctccttccaacaatttatctaccacccgatatataatattttcaaataacccatcaacatttcctccttcatggtctccattgtgtccatc |
233 |
Q |
|
|
||||||||| |||||||||||||||||| ||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
24895107 |
tttcctcctcccaacaatttatctaccatccgatgtataatattttcaaataatccatcaacatttcctccttcatggtctccattgtgtccatc |
24895201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0174 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: scaffold0174
Description:
Target: scaffold0174; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 193 - 237
Target Start/End: Original strand, 32165 - 32209
Alignment:
Q |
193 |
ccatcaacatttcctccttcatggtctccattgtgtccatcttca |
237 |
Q |
|
|
||||||||||||||||| ||||||||||||||||||||| ||||| |
|
|
T |
32165 |
ccatcaacatttcctccctcatggtctccattgtgtccaccttca |
32209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 370 times since January 2019
Visitors: 6696