View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0914_low_83 (Length: 251)
Name: NF0914_low_83
Description: NF0914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0914_low_83 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 12025188 - 12024967
Alignment:
| Q |
1 |
ataaataattaagcttcttaattaacttcgattaattaagttagcgttgagttgaatttgaagtttcgttgaagggaaagttaggagaatgtggaaattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12025188 |
ataaataattaagcttcttaattaacttcgattaattaagttagcgttgagttgaatttgaagtttcgttgaagggaaagttaggagaatgtggaaattc |
12025089 |
T |
|
| Q |
101 |
gcgcgattcgtttcagctaccaaactcgtccgatcgcggcgtttctccaccgcgattcccggtccttgcattgttcacaaacgtggtgctgatatcctcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12025088 |
gcgcgattcgtttcagctaccaaactcgtccgatcgcggcgtttctccaccgcgattcccggtccttgcattgttcacaaacgtggtgctgatatcctcc |
12024989 |
T |
|
| Q |
201 |
acgatccttggttcaacaaggt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
12024988 |
acgatccttggttcaacaaggt |
12024967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 223
Target Start/End: Original strand, 28872105 - 28872155
Alignment:
| Q |
173 |
gttcacaaacgtggtgctgatatcctccacgatccttggttcaacaaggtt |
223 |
Q |
| |
|
||||| ||||||||||||||||| || || |||||||||||||| |||||| |
|
|
| T |
28872105 |
gttcataaacgtggtgctgatattcttcatgatccttggttcaataaggtt |
28872155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 225 times since January 2019
Visitors: 6695