View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0914_low_88 (Length: 249)
Name: NF0914_low_88
Description: NF0914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0914_low_88 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 18 - 220
Target Start/End: Original strand, 50383397 - 50383597
Alignment:
| Q |
18 |
acaaaatgttctaacaaacataaaggatcgattgttttgataccctatcaaatctttattttgatacgttgtaaattaaaattgatcatttctaaaattt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50383397 |
acaaaatgttctaacaaacataaaggatcgattgttttgataccctatcaaatctttattt-gatacgttgtaaattaaaattgatcatttctaaaattt |
50383495 |
T |
|
| Q |
118 |
ggtaacatcccaaatataaattaaatcttaaaaatgaaattgtcattgattttcccttgaagaattatataccgattcagaattccgtttctcttacagg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50383496 |
ggtaacatcccaaatataaattaaatctt-aaaatgaaattgtcattgattttcccttgaagaattatataccgattcagaattccgtttctcttacagg |
50383594 |
T |
|
| Q |
218 |
att |
220 |
Q |
| |
|
||| |
|
|
| T |
50383595 |
att |
50383597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 820 times since January 2019
Visitors: 6705