View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0914_low_89 (Length: 244)

Name: NF0914_low_89
Description: NF0914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0914_low_89
NF0914_low_89
[»] chr1 (1 HSPs)
chr1 (20-178)||(47067462-47067620)


Alignment Details
Target: chr1 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 20 - 178
Target Start/End: Complemental strand, 47067620 - 47067462
Alignment:
20 aaatgtcacaaaatatgaattgacatttgcaaaatcttcacccttgtctaagcaatgtctcttctttatctctcttacccttcttcttgttatttacctt 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47067620 aaatgtcacaaaatatgaattgacatttgcaaaatcttcacccttgtctaagcaatgtctcttctttatctctcttacccttcttcttgttatttacctt 47067521  T
120 cacattacttcatgtgcatgagccacaccacttcaccaaatggggtggctgcaatccct 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47067520 cacattacttcatgtgcatgagccacaccacttcaccaaatggggtggctgcaatccct 47067462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University