View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0914_low_91 (Length: 243)
Name: NF0914_low_91
Description: NF0914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0914_low_91 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 36
Target Start/End: Original strand, 27083074 - 27083109
Alignment:
Q |
1 |
tcggtaatttgatagtattttacggttattgttgaa |
36 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |
|
|
T |
27083074 |
tcggtaatttgatagtattttacggttattgttgaa |
27083109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 687 times since January 2019
Visitors: 6696