View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0915_high_11 (Length: 348)

Name: NF0915_high_11
Description: NF0915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0915_high_11
NF0915_high_11
[»] chr4 (1 HSPs)
chr4 (74-263)||(22080312-22080501)


Alignment Details
Target: chr4 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 74 - 263
Target Start/End: Complemental strand, 22080501 - 22080312
Alignment:
74 tgagatgaagaaattttaggagaataagcgggatgctgaagctaagctggtagagcttaataacaattatgattaaatggcgaggcttggaagggccccc 173  Q
    ||||| ||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
22080501 tgagaagaagaaagtttaggagaataagcgggatgctgaagctaagctgttagagcttaataacaattatgattaaatggcgaggcttggaagggccccc 22080402  T
174 aaaatattactgagttacaggaggaggtacaaaatgctaagatgaatgttgttgagaatatagaaaaggggtttgatcgagccaacgatc 263  Q
    ||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
22080401 aaagtattactgagttacaggaggaggtacaaaatgctaagatgaatgttgctgagaatatagaaaaggggtttgatcgagccaacgatc 22080312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University