View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0915_high_21 (Length: 309)
Name: NF0915_high_21
Description: NF0915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0915_high_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 29 - 280
Target Start/End: Original strand, 41100736 - 41100987
Alignment:
| Q |
29 |
gaagaagaagtagaaaaacgtatattcatattcactcattctttctcttttatcaaacaaactacttactcgtcaagttttcttcattaatttttcaaac |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
41100736 |
gaagaagaagtagaaaaacgtatattcatattcactcattctttctcttttatcaaacaaactacttactcgtccagttttcttcattcatttttcaaac |
41100835 |
T |
 |
| Q |
129 |
agaatgtcgcccccattcgatgattttcgcaacttctttgtgtttataactttctacattctctgtgtcatcatttttgaattcatctgctggataatcc |
228 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
41100836 |
agaatgtcgcccccatttgatgattttcgcaacttctttgtgtttataactttctacgttctcggtgtcatcatttttgaattcatctgctggataatcc |
41100935 |
T |
 |
| Q |
229 |
ggacgtgccacgaccggtggcgttcaccctcaccggcgacagtggcacctga |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41100936 |
ggacgtgccacgaccggtggcgttcaccctcaccggcgacagtggcacctga |
41100987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 244 - 280
Target Start/End: Original strand, 41079351 - 41079387
Alignment:
| Q |
244 |
ggtggcgttcaccctcaccggcgacagtggcacctga |
280 |
Q |
| |
|
||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
41079351 |
ggtggcgttcatcctcaccggcgacagtggcgcctga |
41079387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University