View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0915_high_33 (Length: 232)
Name: NF0915_high_33
Description: NF0915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0915_high_33 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 2777832 - 2777965
Alignment:
| Q |
1 |
tttaaattggctatgcgtaatcatattaatttgcatcttaaagaatccacattccacatgaaagctttgaaatgaaaatgagagtaaatgcttcaagctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2777832 |
tttaaattggctatgcgtaatcatattaatttgcatcttaaagaatccacattccacatgaaagctttgaaatgaaaatgagagtaaatgcttcaagctt |
2777931 |
T |
|
| Q |
101 |
tgtagcatgatcacatctcttggtcagttcgaag |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
2777932 |
tgtagcatgatcacatctcttggtcagttcgaag |
2777965 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 808 times since January 2019
Visitors: 6696