View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0915_low_15 (Length: 421)
Name: NF0915_low_15
Description: NF0915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0915_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 124; Significance: 1e-63; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 103 - 226
Target Start/End: Original strand, 45098483 - 45098606
Alignment:
| Q |
103 |
ttgtatagatagacaaggtttctgtacttggtgaagctattaattacgtgaaagaacttaaagaacgcatatcaatgctggagcaacaatattatgagag |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45098483 |
ttgtatagatagacaaggtttctgtacttggtgaagctattaattacgtgaaagaacttaaagaacgcatatcaatgctggagcaacaatattatgagag |
45098582 |
T |
 |
| Q |
203 |
gaataaaagtaccaagtccataat |
226 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
45098583 |
gaataaaagtaccaagtccataat |
45098606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 13 - 87
Target Start/End: Original strand, 45097396 - 45097470
Alignment:
| Q |
13 |
tttgttattgtagtcagaaattgagaaatatttgtgtaatttattatggtctcactttgatactacacggtaaat |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45097396 |
tttgttattgtagtcagaaattgagaaatatttgtgtaatttattatggtctcactttgatactacacggtaaat |
45097470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University