View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0915_low_23 (Length: 340)
Name: NF0915_low_23
Description: NF0915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0915_low_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 54 - 324
Target Start/End: Complemental strand, 33127412 - 33127141
Alignment:
| Q |
54 |
ccattttcgtgatctcacttgtagacatgttaacctaaattaaataattaaattgaacnnnnnnnnnnnnnnnn-cttagactcctttatgcatgtcttt |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33127412 |
ccattttcgtgatctcacttgtagacatgttaacctaaattaaataattaaattgaactttttttctttctttttcttagactcctttatgcatgtcttt |
33127313 |
T |
|
| Q |
153 |
ggtgtggaacatggttcaaagtttatgcttgtaatccaaacttacttattgatatatgtagttttggtggtttagctcttttcaggaacaaccaatggag |
252 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33127312 |
ggtgtggaacatggttcaaaatttatgcttgtaatccaaacttgcttattgatatatgtagttttggtggtttagctcttttcaggaacaaccaatggag |
33127213 |
T |
|
| Q |
253 |
gtgaaagtgtttatacacaccatgctttcccctcaaaaagaaactaccaccactttaccttaattcaatatt |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33127212 |
gtgaaagtgtttatacacaccatgctttcccctcaaaaagaaactaccaccactttaccttaattcaatatt |
33127141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 666 times since January 2019
Visitors: 6696