View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0915_low_24 (Length: 335)
Name: NF0915_low_24
Description: NF0915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0915_low_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 114; Significance: 9e-58; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 114; E-Value: 9e-58
Query Start/End: Original strand, 164 - 326
Target Start/End: Original strand, 39003214 - 39003376
Alignment:
| Q |
164 |
tgagatgaaaaacaccggcaaaacagcgtgcttttttacaacagggaatttgagtcccatatacttcctccactttagaacttcttctatttgagatgtt |
263 |
Q |
| |
|
|||||||||||| | ||| ||||||| | ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39003214 |
tgagatgaaaaatagcggtaaaacagaatacttttttacaacagggaatctgagtcccatatacttcctccactttagaacttcttctatttgagatgtt |
39003313 |
T |
 |
| Q |
264 |
tgtattattgtatatagattnnnnnnnccacttatatatgtgtatataaaatcttaattttct |
326 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
39003314 |
tgtattattgtatatagattaaaaaaaccacttatatatgtgtatataaaatcttaattttct |
39003376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 164 - 222
Target Start/End: Complemental strand, 54425691 - 54425633
Alignment:
| Q |
164 |
tgagatgaaaaacaccggcaaaacagcgtgcttttttacaacagggaatttgagtccca |
222 |
Q |
| |
|
||||||| ||||| ||| |||||| ||||||||||||||||||||||| | ||||||| |
|
|
| T |
54425691 |
tgagatgcaaaactacggtaaaacatcgtgcttttttacaacagggaatctcagtccca |
54425633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University