View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0915_low_33 (Length: 319)
Name: NF0915_low_33
Description: NF0915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0915_low_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 1e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 103 - 245
Target Start/End: Original strand, 7445082 - 7445224
Alignment:
Q |
103 |
ctttctctacttgtgtgtatgatggtgatcttcgtggacagatgcatggaccgaaaaggaaataaattgtgatataccaattaggttgtgttctgagttc |
202 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7445082 |
ctttctctacttgtgtgtatgatggtgatcttcgtggacagatgcatggaccgaaaaggaaataaattgtgatataccaattaggttgtgttctgagttc |
7445181 |
T |
 |
Q |
203 |
tcacgttctcccacatgttctcaatcatgcacatattgttgga |
245 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
7445182 |
tcacgttctcccacatgttctcaatcatgcacatattgctgga |
7445224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University