View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0915_low_37 (Length: 309)
Name: NF0915_low_37
Description: NF0915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0915_low_37 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 124; Significance: 9e-64; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 124; E-Value: 9e-64
Query Start/End: Original strand, 83 - 251
Target Start/End: Complemental strand, 3973706 - 3973526
Alignment:
| Q |
83 |
gacatcatcaatattaacctccaatgcaacagttagtaacaacaacctatactccacta------------tttgatcaaagtgcacaatcgaatattat |
170 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3973706 |
gacatcatcaatattaacctgcaatgcaacagttagtaacaacaacctatactccactaacctggtactattttgatcaaagtgcacaatcgaatattat |
3973607 |
T |
|
| Q |
171 |
tttaaaatttcgtaaatttatcgactatttgtaactctttaaacgttctgggatccaaatgactatggatcctcgccatta |
251 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3973606 |
tttaaaatttcgtaaatttatggactatttgtaactctttaaacgttctgggatccaaactactatggatcctcgccatta |
3973526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 639 times since January 2019
Visitors: 6696