View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0915_low_47 (Length: 267)
Name: NF0915_low_47
Description: NF0915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0915_low_47 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 10 - 239
Target Start/End: Complemental strand, 25377806 - 25377578
Alignment:
Q |
10 |
gagatgaaattatgggaaaagagagatatataaaattggtcnnnnnnnnnnnngacaaaatataaattggtctttgtgatagataaataaagtttttgca |
109 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||| || |
|
|
T |
25377806 |
gagatgaaattatgggaaaagagagatatataaaattggtcttttttttttt-gacaaaatataaattggtctttgtgatagataaatgaagtttttaca |
25377708 |
T |
 |
Q |
110 |
taaatgttttagtccttatnnnnnnnttgaaatcttactgttttctcaataatctttttctttaatatttagtcttcatgatagttatatgtaaaggaaa |
209 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
25377707 |
taaatgttttagtccttataaaaaaattgaaatcttactgttttctcaataatttttttctttaatatttagtcttcatgatagttatatgtaaaggaaa |
25377608 |
T |
 |
Q |
210 |
ttttaaaattcattattgaataaaatatat |
239 |
Q |
|
|
|||||||||||||||||||||||||||||| |
|
|
T |
25377607 |
ttttaaaattcattattgaataaaatatat |
25377578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University