View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0915_low_50 (Length: 258)
Name: NF0915_low_50
Description: NF0915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0915_low_50 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 14 - 72
Target Start/End: Complemental strand, 46343948 - 46343890
Alignment:
Q |
14 |
atatcaatcgactttcatgtcactaaactagtcaccaaacataaaagtaatcaaatcag |
72 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46343948 |
atatcaatcgactttcatgtcactaaactagtcaccaaacataaaagtaatcaaatcag |
46343890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University