View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0915_low_53 (Length: 251)
Name: NF0915_low_53
Description: NF0915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0915_low_53 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 247
Target Start/End: Original strand, 26304506 - 26304752
Alignment:
| Q |
1 |
aacagttccacaaccaatccaatttctgaacacactagtcactctaacagaattgcttctaatcttagtaaacgaggattgagattgagccgatgttgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
26304506 |
aacagttccacaaccaatccaatttctgaacacactagtcactctaacagaattgcttctaatcttagtaaatgaggattgagattgagccgatgttgat |
26304605 |
T |
 |
| Q |
101 |
gatgttggagtagaaaaagttgaatcaggaggcgtagtagtatcagttttgttattttgaccatcttttttacccttcttactcatcaaattatgataca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26304606 |
gatgttggagtagaaaaagttgaatcaggaggcgtagtagtatcagttttgttattttgaccatcttttttacccttcttactcatcaaattatgataca |
26304705 |
T |
 |
| Q |
201 |
aagaaggaaatgagagactatcaagcttctcatgattcatctcactc |
247 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||| |||||||| |
|
|
| T |
26304706 |
aagaaggaaatgagaaactatcaagcttgtcatgattcttctcactc |
26304752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 166 - 237
Target Start/End: Complemental strand, 12134033 - 12133962
Alignment:
| Q |
166 |
ttttttacccttcttactcatcaaattatgatacaaagaaggaaatgagagactatcaagcttctcatgatt |
237 |
Q |
| |
|
||||| |||||||||| |||||||||| ||||||||||||||||||||| | | |||| |||||||||||| |
|
|
| T |
12134033 |
tttttaacccttcttaatcatcaaattgcgatacaaagaaggaaatgagaaagtctcaaacttctcatgatt |
12133962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University