View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0915_low_56 (Length: 250)
Name: NF0915_low_56
Description: NF0915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0915_low_56 |
 |  |
|
[»] scaffold0205 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0205 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: scaffold0205
Description:
Target: scaffold0205; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 31 - 230
Target Start/End: Complemental strand, 13191 - 12992
Alignment:
Q |
31 |
gtttgagtcttgaagcaataaatcaaaaaatcaaactcacgaagacatcataaaacagctaaaaacattgagatcatataatttgactaatattacgacc |
130 |
Q |
|
|
|||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||| | |
|
|
T |
13191 |
gtttgagtcttgaagcaatacatcaaaaaatcaaactcacggagacatcataaaacagctaaaaacactgagatcatataatttgactaatattacgagc |
13092 |
T |
 |
Q |
131 |
tttatacattgcaggttgtttccttaatgccatgtgtagttgatagcaactttgatgtcttttatacaatggaagactcttcatcggaaaagtctgatga |
230 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
13091 |
tttatacattgcaggttgtttccttaatgccatgtgtagttgatagcaactttgatgtcttttatacaatggaagactcttcatcggaaaagtccgatga |
12992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University