View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0915_low_58 (Length: 237)
Name: NF0915_low_58
Description: NF0915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0915_low_58 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 4 - 150
Target Start/End: Original strand, 12888691 - 12888836
Alignment:
Q |
4 |
gtagtttctcacagtgtgagatctcgaccgttcacatccaatcaaacaaacccagattaataactgcatccatgcagtaactgtgttaaatcaatatcta |
103 |
Q |
|
|
||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12888691 |
gtagtttctcacagtgtgagatctcgaccgttcacttccaatcaaacaa-cccagattaataactgcatccatgcagtaactgtgttaaatcaatatcta |
12888789 |
T |
 |
Q |
104 |
gaccgtttgaatatatttggttaagcctttttggtcctcccatgagt |
150 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12888790 |
gaccgtttgaatatatttggttaagcctttttggtcctcccatgagt |
12888836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 646 times since January 2019
Visitors: 6705