View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0915_low_59 (Length: 232)

Name: NF0915_low_59
Description: NF0915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0915_low_59
NF0915_low_59
[»] chr2 (1 HSPs)
chr2 (1-134)||(2777832-2777965)


Alignment Details
Target: chr2 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 2777832 - 2777965
Alignment:
1 tttaaattggctatgcgtaatcatattaatttgcatcttaaagaatccacattccacatgaaagctttgaaatgaaaatgagagtaaatgcttcaagctt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2777832 tttaaattggctatgcgtaatcatattaatttgcatcttaaagaatccacattccacatgaaagctttgaaatgaaaatgagagtaaatgcttcaagctt 2777931  T
101 tgtagcatgatcacatctcttggtcagttcgaag 134  Q
    ||||||||||||||||||||||||||||||||||    
2777932 tgtagcatgatcacatctcttggtcagttcgaag 2777965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University