View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0916_high_8 (Length: 358)
Name: NF0916_high_8
Description: NF0916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0916_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 116; Significance: 6e-59; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 183 - 332
Target Start/End: Complemental strand, 45616122 - 45615971
Alignment:
Q |
183 |
gtgcctactaattactcttattgtttagtctatgatttaa-tattttatttttgactgatgtcttaaccacccattttct-taatgatttcttttccaaa |
280 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||| ||| |||||||||||||||| |||||||| ||||||||| ||||||||||||||| ||| |
|
|
T |
45616122 |
gtgcctactaattactcttaatgtttagtctatgatttaagtatcttatttttgactgatgacttaaccaaccattttctctaatgatttcttttcaaaa |
45616023 |
T |
 |
Q |
281 |
attctatttctaaaagggcaagctggtatcctactttgaacctagctatatt |
332 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45616022 |
attctatttctaaaagggcaagctggtatcctactttgaacctagctatatt |
45615971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 310 times since January 2019
Visitors: 6696