View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0916_low_10 (Length: 489)
Name: NF0916_low_10
Description: NF0916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0916_low_10 |
 |  |
|
| [»] scaffold0082 (2 HSPs) |
 |  |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 380; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 380; E-Value: 0
Query Start/End: Original strand, 18 - 405
Target Start/End: Original strand, 17870274 - 17870661
Alignment:
| Q |
18 |
ggacatcatcaatagaacctggctggggtagtgaggcccattcctaaccagtttcgaaaaggtccgctcatgctggagggagcatccccacttagtgatc |
117 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17870274 |
ggacataatcaatagaacctggctggggtagtgaggcccattcctaaccagtttcgaaaaggtccgctcatgctggagggagcatccccacttagtgatc |
17870373 |
T |
 |
| Q |
118 |
ggtccgctagttcgcgcaaatccgaataagttatcacggacgagccacatgcagggaaacttgcacgtgtggttctggccgggctttcctgaggtatcta |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17870374 |
ggtccgctagttcgcgcaaatccgaataagttatcacggacgagccacatgcagggaaacttgcacgtgtggttctggccgggctttcctgaggtatcta |
17870473 |
T |
 |
| Q |
218 |
ataaccttgcttctgctcgccgctggcgcacctctcctaactattgcccatttattccggaataatctttttaggagggacaattttacatatttctgcc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17870474 |
ataaccttgcttctgctcgccgctggcgcacctctcctaactattgcccatttattccggaataatctttttaggagggacaattttacatatttctgcc |
17870573 |
T |
 |
| Q |
318 |
aaatccttctattattaagtacggctggtaccatttcgatgtgtttcgattcttccgaacaagagaggtctgatgcttttgaattcat |
405 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
17870574 |
aaatccttctattattaagtacggctggtaccatttcgatgtgtttcgattcttccgaacaagagaggtttgatgcttttgaattcat |
17870661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 59; Significance: 9e-25; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 343 - 405
Target Start/End: Original strand, 21956981 - 21957043
Alignment:
| Q |
343 |
tggtaccatttcgatgtgtttcgattcttccgaacaagagaggtctgatgcttttgaattcat |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
21956981 |
tggtaccatttcgatgtgtttcgattcttccgaacaagagaggtttgatgcttttgaattcat |
21957043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0082 (Bit Score: 47; Significance: 1e-17; HSPs: 2)
Name: scaffold0082
Description:
Target: scaffold0082; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 154 - 200
Target Start/End: Complemental strand, 57389 - 57343
Alignment:
| Q |
154 |
cggacgagccacatgcagggaaacttgcacgtgtggttctggccggg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
57389 |
cggacgagccacatgcagggaaacttgcacgtgtggttctggccggg |
57343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0082; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 168 - 197
Target Start/End: Original strand, 5053 - 5082
Alignment:
| Q |
168 |
gcagggaaacttgcacgtgtggttctggcc |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
5053 |
gcagggaaacttgcacgtgtggttctggcc |
5082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 44; Significance: 8e-16; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 157 - 200
Target Start/End: Complemental strand, 25283919 - 25283876
Alignment:
| Q |
157 |
acgagccacatgcagggaaacttgcacgtgtggttctggccggg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25283919 |
acgagccacatgcagggaaacttgcacgtgtggttctggccggg |
25283876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 154 - 200
Target Start/End: Original strand, 53710 - 53756
Alignment:
| Q |
154 |
cggacgagccacatgcagggaaacttgcacgtgtggttctggccggg |
200 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
53710 |
cggacgagccacatgaagggaaacttgcacgtgtggttctggccggg |
53756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 299 - 364
Target Start/End: Original strand, 22817623 - 22817688
Alignment:
| Q |
299 |
aattttacatatttctgccaaatccttctattattaagtacggctggtaccatttcgatgtgtttc |
364 |
Q |
| |
|
||||||||| |||||| | ||||||||||||||||||||||| || || ||||||| ||||||||| |
|
|
| T |
22817623 |
aattttacacatttctacaaaatccttctattattaagtacgactcgttccatttccatgtgtttc |
22817688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University