View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0916_low_14 (Length: 415)
Name: NF0916_low_14
Description: NF0916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0916_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 364; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 364; E-Value: 0
Query Start/End: Original strand, 1 - 376
Target Start/End: Complemental strand, 52926159 - 52925784
Alignment:
| Q |
1 |
ggtggtcttgttcaacttgctattgaagttgaggatcgtgctcaccgctccgcaatcaccagagtaaatgctgatgatgttcgtgtcactgtagctgctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52926159 |
ggtggtcttgttcaacttgctattgaagttgaagatcgtgctcaccgctccgcaatcaccagagtaaatgctgatgatgttcgtgtcactgtagctgctc |
52926060 |
T |
 |
| Q |
101 |
ctgctgctcgtggagaagctaacaatgaacttttggagtttatgggaaaggttttaggtttaagattgagtcaaatgactcttcagagaggatggaataa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52926059 |
ctgctgctcgtggagaagctaacaatgaacttttggagtttatgggaaaggttttaggtttaagattgagtcaaatgactcttcagagaggatggaataa |
52925960 |
T |
 |
| Q |
201 |
caagtcaaagcttcttgtggtcagtcatgtcttcttcaacttaaccaagtagtaagtatttctcaacaaacatatatactaacgctaattttcaccatca |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
52925959 |
caagtcaaagcttcttgtggtcagtcatgtcttcttcaacttaaccaagtagtaagtatttctcaacaaacatatatactaatgctaattttcaccatca |
52925860 |
T |
 |
| Q |
301 |
tttcaggtggaggatctcactgctagacaagtttatgagaaacttttggaggctgtgcaaccttgatgatgtccat |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
52925859 |
tttcaggtggaggatctcactgctagacaagtttatgagaaacttttggaggctgtgcaaccttgatgctgtccat |
52925784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University