View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0916_low_20 (Length: 358)

Name: NF0916_low_20
Description: NF0916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0916_low_20
NF0916_low_20
[»] chr7 (1 HSPs)
chr7 (183-332)||(45615971-45616122)


Alignment Details
Target: chr7 (Bit Score: 116; Significance: 6e-59; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 183 - 332
Target Start/End: Complemental strand, 45616122 - 45615971
Alignment:
183 gtgcctactaattactcttattgtttagtctatgatttaa-tattttatttttgactgatgtcttaaccacccattttct-taatgatttcttttccaaa 280  Q
    |||||||||||||||||||| ||||||||||||||||||| ||| |||||||||||||||| |||||||| ||||||||| ||||||||||||||| |||    
45616122 gtgcctactaattactcttaatgtttagtctatgatttaagtatcttatttttgactgatgacttaaccaaccattttctctaatgatttcttttcaaaa 45616023  T
281 attctatttctaaaagggcaagctggtatcctactttgaacctagctatatt 332  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
45616022 attctatttctaaaagggcaagctggtatcctactttgaacctagctatatt 45615971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 176 times since January 2019
Visitors: 6713