View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0916_low_23 (Length: 341)
Name: NF0916_low_23
Description: NF0916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0916_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 1 - 176
Target Start/End: Original strand, 54952990 - 54953166
Alignment:
Q |
1 |
ctttgccaagtatgaataattctatagatggttaatttcaaggatttatatatacataggccattatgtacatgggaatgccagtatta-tttattagtc |
99 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
54952990 |
ctttgccaagtatgaataattctatagatggttaatttcaaggatttatatatacataggccattatgtacatgggaatgccagtattattttattagtc |
54953089 |
T |
 |
Q |
100 |
ttattatagcaagggtccctgcaaggtttattctgtaacccttcaccgtgtgggaaagtttttatctagtttgataa |
176 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
T |
54953090 |
ttattatagcaaaggtccctgcaaggtttattctgtaacacttcaccgtgtggggaagtttttatctagtttgataa |
54953166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 210 - 241
Target Start/End: Original strand, 54953204 - 54953235
Alignment:
Q |
210 |
atctaattgtattgtaatatatatgatgatgt |
241 |
Q |
|
|
|||||||||||||||||||||||||||||||| |
|
|
T |
54953204 |
atctaattgtattgtaatatatatgatgatgt |
54953235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University