View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0916_low_26 (Length: 312)
Name: NF0916_low_26
Description: NF0916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0916_low_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 1 - 292
Target Start/End: Complemental strand, 27660861 - 27660570
Alignment:
Q |
1 |
ttgcctttgaaattatatttcttttgttattgaacatgtttgtaagtttgcttaagttttcttttgcttcatgttattggtgtgacgctatggacattgt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
27660861 |
ttgcctttgaaattatatttcttttgttattgaacatgtttgtaagtttgcttaagttttcttttgcttcatgttattggtgtgacgctatggacattgt |
27660762 |
T |
 |
Q |
101 |
attgatttatttcattattatgtttgccttttgcagtgaaaaaatgtctacaacctcttccaatttcaaatgggcacaattgaaaagataggatgggtca |
200 |
Q |
|
|
||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
27660761 |
attgatttatttcattattgtgtttgtcttttgcagtgaaaaaatgtctacaacctcttccaatttcaaatgggcacaattgaaaagataggatgggtca |
27660662 |
T |
 |
Q |
201 |
ctattttggttctagtttagttgttagtgttgtgtgttgctgtttcggtaggattgttttcaggttttgggggctgcattctctgatgatgt |
292 |
Q |
|
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||| |
|
|
T |
27660661 |
ctattttggttctagtttagctgttagtgttgtgtgttgctgtttcggtaggattgttttcagcttttgggggctgcattctctgttgatgt |
27660570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 218; Significance: 1e-120; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 5 - 281
Target Start/End: Original strand, 37600865 - 37601141
Alignment:
Q |
5 |
ctttgaaattatatttcttttgttattgaacatgtttgtaagtttgcttaagttttcttttgcttcatgttat-tggtgtgacgctatggacattgtatt |
103 |
Q |
|
|
|||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
T |
37600865 |
ctttgaaattatatttcttttgttgttcaacatgtttgtaagtttgcttaagttttcttttgcttcatgttatctggtgtgaagctatggacattgtatt |
37600964 |
T |
 |
Q |
104 |
gatttatttcattattatgtttgccttttgcagtgaaaaaatgtctacaacctcttccaatttcaaatgggcacaattgaaaagataggatgggtcacta |
203 |
Q |
|
|
|||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
37600965 |
gatttatttcattattgtgtttgccttttgcagtgaaaaaatgtctacatgctcttccaatttcaaatgagcacaattgaaaagataggatgggtcacta |
37601064 |
T |
 |
Q |
204 |
ttttggttctagtttagttgttagtgttgtgtgttgctgtttcggtaggattgttttcaggttttgggggctgcattc |
281 |
Q |
|
|
|||| |||||||||| | |||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
37601065 |
tttt-gttctagttttgctgttagtgttgtgtattgctgtttcggtaggattgttttcagcttttgggggctgcattc |
37601141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 80 - 269
Target Start/End: Original strand, 33356323 - 33356513
Alignment:
Q |
80 |
gtgtgacgctatggacattgtattgatttatttcattattatgtttgccttttgcagtg-aaaaaatgtctacaacctcttccaatttcaaatgggcaca |
178 |
Q |
|
|
|||||| |||||| ||||||| ||||||| |||||| | | |||||||||||||||||| |||||||||||| || |||||| |||||||| | | |||| |
|
|
T |
33356323 |
gtgtgaagctatgaacattgtgttgatttgtttcatgactgtgtttgccttttgcagtgaaaaaaatgtctagaaactcttctaatttcaattagacaca |
33356422 |
T |
 |
Q |
179 |
attgaaaagataggatgggtcactattttggttctagtttagttgttagtgttgtgtgttgctgtttcggtaggattgttttcaggttttg |
269 |
Q |
|
|
|||||||||| ||| ||| | | |||||||| | | | ||||||||||||||||| | ||||| | ||| ||| ||||||| ||||| |
|
|
T |
33356423 |
attgaaaagaaagggtggttagttgttttggttgtgatattgttgttagtgttgtgtggtattgtttagatagaatttttttcagcttttg |
33356513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 153
Target Start/End: Complemental strand, 5745351 - 5745299
Alignment:
Q |
102 |
ttgatttatttcattattatgtttgccttttgcagtgaa-aaaatgtctacaa |
153 |
Q |
|
|
||||||| |||||| | | |||||||||||||||||||| ||||||||||||| |
|
|
T |
5745351 |
ttgatttgtttcatgactgtgtttgccttttgcagtgaaaaaaatgtctacaa |
5745299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 80 - 269
Target Start/End: Original strand, 18080583 - 18080773
Alignment:
Q |
80 |
gtgtgacgctatggacattgtattgatttatttcattattatgtttgccttttgcagtg-aaaaaatgtctacaacctcttccaatttcaaatgggcaca |
178 |
Q |
|
|
|||||| |||||| ||||||| ||||||| |||||| | | |||||||||||||||||| |||||||||||| || |||||| |||||||| | | |||| |
|
|
T |
18080583 |
gtgtgaagctatgaacattgtgttgatttgtttcatgactgtgtttgccttttgcagtgaaaaaaatgtctagaaactcttctaatttcaattagacaca |
18080682 |
T |
 |
Q |
179 |
attgaaaagataggatgggtcactattttggttctagtttagttgttagtgttgtgtgttgctgtttcggtaggattgttttcaggttttg |
269 |
Q |
|
|
|||||||||| ||| ||| | | |||||||| | | | ||||||||||||||||| | ||||| | ||| ||| ||||||| ||||| |
|
|
T |
18080683 |
attgaaaagaaagggtggttagttgttttggttgtgatattgttgttagtgttgtgtggtattgtttagatagaatttttttcagcttttg |
18080773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 80 - 160
Target Start/End: Original strand, 30265675 - 30265756
Alignment:
Q |
80 |
gtgtgacgctatggacattgtattgatttatttcattattatgtttgccttttgcagtg-aaaaaatgtctacaacctcttc |
160 |
Q |
|
|
|||||| |||||| ||||||| ||||||| |||||| | | |||||||||||||||||| |||||||||||| || |||||| |
|
|
T |
30265675 |
gtgtgaagctatgaacattgtgttgatttgtttcatgactgtgtttgccttttgcagtgaaaaaaatgtctagaaactcttc |
30265756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 418 times since January 2019
Visitors: 6703