View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0916_low_28 (Length: 300)
Name: NF0916_low_28
Description: NF0916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0916_low_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 67; Significance: 9e-30; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 69 - 139
Target Start/End: Original strand, 34864966 - 34865036
Alignment:
Q |
69 |
ggtggttgtgactgtaaggctacacactcatgttgcttctttttcatgtggcaaagacaaaactagacttg |
139 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
34864966 |
ggtggttgtgactgtaaggctacacactcatgttgcttctttttcacgtggcaaagacaaaactagacttg |
34865036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 199 - 247
Target Start/End: Original strand, 34865096 - 34865144
Alignment:
Q |
199 |
tgcagctgttttggagaaacaccgtgcaggtcaattgattcctcttctc |
247 |
Q |
|
|
||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34865096 |
tgcagctattttggagaaacaccgtgcaggtcaattgattcctcttctc |
34865144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 199 - 247
Target Start/End: Original strand, 34869473 - 34869521
Alignment:
Q |
199 |
tgcagctgttttggagaaacaccgtgcaggtcaattgattcctcttctc |
247 |
Q |
|
|
|||||||||||||||||||||||| ||||||||||| |||| |||||| |
|
|
T |
34869473 |
tgcagctgttttggagaaacaccggacaggtcaattggttccccttctc |
34869521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University