View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0916_low_28 (Length: 300)

Name: NF0916_low_28
Description: NF0916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0916_low_28
NF0916_low_28
[»] chr3 (3 HSPs)
chr3 (69-139)||(34864966-34865036)
chr3 (199-247)||(34865096-34865144)
chr3 (199-247)||(34869473-34869521)


Alignment Details
Target: chr3 (Bit Score: 67; Significance: 9e-30; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 69 - 139
Target Start/End: Original strand, 34864966 - 34865036
Alignment:
69 ggtggttgtgactgtaaggctacacactcatgttgcttctttttcatgtggcaaagacaaaactagacttg 139  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
34864966 ggtggttgtgactgtaaggctacacactcatgttgcttctttttcacgtggcaaagacaaaactagacttg 34865036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 199 - 247
Target Start/End: Original strand, 34865096 - 34865144
Alignment:
199 tgcagctgttttggagaaacaccgtgcaggtcaattgattcctcttctc 247  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||    
34865096 tgcagctattttggagaaacaccgtgcaggtcaattgattcctcttctc 34865144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 199 - 247
Target Start/End: Original strand, 34869473 - 34869521
Alignment:
199 tgcagctgttttggagaaacaccgtgcaggtcaattgattcctcttctc 247  Q
    ||||||||||||||||||||||||  ||||||||||| |||| ||||||    
34869473 tgcagctgttttggagaaacaccggacaggtcaattggttccccttctc 34869521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University