View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0916_low_30 (Length: 280)
Name: NF0916_low_30
Description: NF0916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0916_low_30 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 121; Significance: 5e-62; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 37 - 230
Target Start/End: Original strand, 7501304 - 7501493
Alignment:
| Q |
37 |
gtgagatgaacttacaattttgaataatcacttaactttttatgctatcagcacgtaactaaagtaagttattcttgtttagctaattagtatagttaac |
136 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
7501304 |
gtgaaatgaacttacaattttgaataatcacttaactttttatgctatcagcatttaactaaagttagttatttttgtttagctaattagtatagttaac |
7501403 |
T |
 |
| Q |
137 |
tttttaccgccnnnnnnnnnngtatagttaactttgtaaatgataatttcaggcgtaaaacttacattagaattcatctgagagttgatgatgt |
230 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7501404 |
tttttaccgccaaaaaaata--tatagttaactttgtaaatgataa--tcaggcgtaaaacatacattagaattcatctgagagttgatgatgt |
7501493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University