View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0916_low_31 (Length: 272)
Name: NF0916_low_31
Description: NF0916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0916_low_31 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 36 - 261
Target Start/End: Original strand, 14705232 - 14705457
Alignment:
| Q |
36 |
gcacccgataacgtgaactcggtgttgaacgtgatagccaacatgcaacaacaaaaccaccgtgtgctatttgatgtacccaactcaagaattggtattg |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14705232 |
gcacccgataacgtgaactcggtgttgaacgtgatagccaacatgcaacaacaaaaccaccgtgtgctatttgatgtacccaactcaagaattggtattg |
14705331 |
T |
|
| Q |
136 |
ctcgtgagctttgcacctaataagtggttcctggttaagatcaattttcttaggtacaataataatcttgtcgaattgggattatgagttaattatttgg |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14705332 |
ctcgtgagctttgcacctaataagtggttcttggttaagatcaattttcttaggtacaataataatcttgtcgaattgggattatgagttaattatttgg |
14705431 |
T |
|
| Q |
236 |
gtagttggtattttatttttattcat |
261 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
14705432 |
gtagttggtattttatttttattcat |
14705457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 36 - 158
Target Start/End: Complemental strand, 4035653 - 4035531
Alignment:
| Q |
36 |
gcacccgataacgtgaactcggtgttgaacgtgatagccaacatgcaacaacaaaaccaccgtgtgctatttgatgtacccaactcaagaattggtattg |
135 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||| | |||||| || ||||| || ||||| ||| |
|
|
| T |
4035653 |
gcacccgataatgtgaactcggtgttgaacgtgatagccaacatgcagcaacaaaaccaccgtgtgctctatgatgtccctaactctagggttggtgttg |
4035554 |
T |
|
| Q |
136 |
ctcgtgagctttgcacctaataa |
158 |
Q |
| |
|
|||||||||| || || |||||| |
|
|
| T |
4035553 |
ctcgtgagctatgtacttaataa |
4035531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 67; Significance: 8e-30; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 36 - 158
Target Start/End: Original strand, 13952050 - 13952172
Alignment:
| Q |
36 |
gcacccgataacgtgaactcggtgttgaacgtgatagccaacatgcaacaacaaaaccaccgtgtgctatttgatgtacccaactcaagaattggtattg |
135 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||| || | |||||| || ||||| || ||||| ||| |
|
|
| T |
13952050 |
gcacccgataatgtgaactcggtgttgaacgtgatagccaacatgcagcaacaaaaccaccgtgttctctatgatgtccctaactctagggttggtgttg |
13952149 |
T |
|
| Q |
136 |
ctcgtgagctttgcacctaataa |
158 |
Q |
| |
|
|||||||||| || || |||||| |
|
|
| T |
13952150 |
ctcgtgagctatgtacttaataa |
13952172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1189 times since January 2019
Visitors: 6711