View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0916_low_32 (Length: 251)
Name: NF0916_low_32
Description: NF0916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0916_low_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 49858542 - 49858783
Alignment:
| Q |
1 |
aatagcacattcgagccattgtgttgcaggatgacgcgacataattgcatcgaatttcatattagactttgcgcagtacgagaatgtgacacataaaggt |
100 |
Q |
| |
|
|||||||||||| ||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
49858542 |
aatagcacattcaagccactgtgtcacaggatgacgcgacataattgcatcgaatttcatattagactttgcgccgtacgagaatgtgacacataaaggt |
49858641 |
T |
|
| Q |
101 |
tgggtttctcgaatcacttcagtcgcaatatatgcattttatgtcataactaaacccaatctaagaggtttaatcacttggacatagttacacatatgat |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49858642 |
tgggtttctcgaatcacttccctcgcaatatatgcattttatgccataactaaacccaatctaagaggtttaatcacttggacatagttacacatatgat |
49858741 |
T |
|
| Q |
201 |
tagacttttcttagtgtaataccgccttcactcaagaataat |
242 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
49858742 |
tagacttttcttagcgtaatactgccttcactcaagaataat |
49858783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 476 times since January 2019
Visitors: 6704