View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0916_low_35 (Length: 227)
Name: NF0916_low_35
Description: NF0916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0916_low_35 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 5 - 142
Target Start/End: Original strand, 48107924 - 48108063
Alignment:
Q |
5 |
tagtccaaagaatgaacgcctagccctgcatatatggtgtgaagatatatatgttagatattaaaagaattgtagcactgaattat--agagagggagag |
102 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||| |
|
|
T |
48107924 |
tagtccaaagaatgaacgcctagccctgcatatatggtgtgaagatatatatgttagatattaaaagaatagtagcactgaattatagagagagggagag |
48108023 |
T |
 |
Q |
103 |
attgaaacctgagataaataaaaggaaagaggtgatgatg |
142 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
48108024 |
attgaaacctgagataaataaaaggaaagaggtggtgatg |
48108063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 468 times since January 2019
Visitors: 6717