View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0916_low_40 (Length: 205)
Name: NF0916_low_40
Description: NF0916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0916_low_40 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 108
Target Start/End: Original strand, 30877919 - 30878026
Alignment:
| Q |
1 |
aacaatggaataaggagaggtgtttgttctgtgtcagagttgttttggagtgtgatagtgatgaaaatgacagtgtcagtgaacaagtgacagtagatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30877919 |
aacaatggaataaggagaggtgtttgttctgtgtcagagttgttttggagtgtgatagtgatgaaaatgacagtgtcagtgaacaagtgacagtagatga |
30878018 |
T |
|
| Q |
101 |
tgatgatg |
108 |
Q |
| |
|
|||||||| |
|
|
| T |
30878019 |
tgatgatg |
30878026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 593 times since January 2019
Visitors: 6718