View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0916_low_9 (Length: 495)
Name: NF0916_low_9
Description: NF0916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0916_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 142 - 352
Target Start/End: Complemental strand, 6994763 - 6994557
Alignment:
| Q |
142 |
ttattttgaagaatgtattcaaatatatatagttaacaagaggatttggcatataacatggttttggtgcagggagcagtatcacccaacattgcagcta |
241 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6994763 |
ttattttgaagaatgtattcaaatata----gttaacaagaggatttggcatataacatggttttggtgcagggagcagtatcacccaacattgcagcta |
6994668 |
T |
|
| Q |
242 |
tgttacatagtcagtcaagtaccacttccacatctcagcttggaggtactttcaactctttcatcatatatttattgattttcatgttccaaattaatta |
341 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6994667 |
tgttacatagtcagtcaagtaccacttccacatctcagcttggaggtactttcaactctttcatcatatatttattgattttcatgttccaaattaatta |
6994568 |
T |
|
| Q |
342 |
catataatata |
352 |
Q |
| |
|
||||||||||| |
|
|
| T |
6994567 |
catataatata |
6994557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 13 - 89
Target Start/End: Complemental strand, 6994948 - 6994872
Alignment:
| Q |
13 |
caattatcttttaaaaaatagaatgaaataaaatgtaataacctctgtttttgtagcattttatttatattcaattt |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6994948 |
caattatcttttaaaaaatagaatgaaataaaatgtaataacctctgtttttgtagcattttattaatattcaattt |
6994872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 819 times since January 2019
Visitors: 6705