View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0917_high_15 (Length: 385)
Name: NF0917_high_15
Description: NF0917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0917_high_15 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 177; Significance: 3e-95; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 177; E-Value: 3e-95
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 20982148 - 20981928
Alignment:
| Q |
1 |
aacaaatacaaattacaatcaccaagcaatgaattacttaataaaggtaacacacaaacagaatattaacacgttatagttaagataaaatgtgacataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
20982148 |
aacaaatacaaattacaatcaccaagcaatgaattacttaataaaggtaaaacacaaacagaatattaacacgttatagttaagataaaatgtgtcataa |
20982049 |
T |
 |
| Q |
101 |
taattaagactaattttttagttgttaaatatatatgcgtttttcttgtt-nnnnnnnnttattttccttggatatatttacaaaagtttagttattgag |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
20982048 |
taattaagactaattttttagttgttaaatatatatgcgtttttcttgttaaaaaaaaattattttccttggatatatttacaaaagtttagttgttgag |
20981949 |
T |
 |
| Q |
200 |
ttctctttatgtatgttgggt |
220 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
20981948 |
ttctctttatgtatgttgggt |
20981928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 316 - 357
Target Start/End: Complemental strand, 20998355 - 20998315
Alignment:
| Q |
316 |
ccattgcctcgtagaagttgaactcttaagtttatgccaatt |
357 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||||||| |
|
|
| T |
20998355 |
ccattgcctcttagaagttgaactcttaa-tttatgccaatt |
20998315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University