View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0917_high_28 (Length: 266)
Name: NF0917_high_28
Description: NF0917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0917_high_28 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 107 - 236
Target Start/End: Complemental strand, 3050574 - 3050445
Alignment:
| Q |
107 |
ctactcaagattgttatacatgtgtccataatatcaactattgatttatttaatcaacgattgatattagccgtttttaattgatgagatcatgagtgct |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3050574 |
ctactcaagattgttatacatgtgtccataatatcaactattgatttatttaatcaacgattgatattagccgtttttaattgatgagatcatgagtgct |
3050475 |
T |
|
| Q |
207 |
cccaatgatttgagttacccgggttggtat |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3050474 |
cccaatgatttgagttacccgggttggtat |
3050445 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 121 - 229
Target Start/End: Complemental strand, 3037136 - 3037019
Alignment:
| Q |
121 |
tatacatgtgtccataatatcaactattgatttatttaatca-------acgattgatattag--ccgtttttaattgatgagatcatgagtgctcccaa |
211 |
Q |
| |
|
|||| ||||||| ||||||||||| |||||||| |||||||| | ||||||||||| ||| ||||||||||||| ||||||||||||||| |
|
|
| T |
3037136 |
tatatatgtgtctataatatcaaccattgatttgtttaatcacaaatcaatgattgatattatacccgcttttaattgatgaaatcatgagtgctcccgg |
3037037 |
T |
|
| Q |
212 |
tgatttgagttacccggg |
229 |
Q |
| |
|
||||||||||||| |||| |
|
|
| T |
3037036 |
tgatttgagttactcggg |
3037019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 760 times since January 2019
Visitors: 6719