View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0917_high_35 (Length: 251)
Name: NF0917_high_35
Description: NF0917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0917_high_35 |
 |  |
|
[»] chr6 (4 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 90; Significance: 1e-43; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 118 - 251
Target Start/End: Original strand, 13178549 - 13178682
Alignment:
Q |
118 |
tgatagcatgaccgatccaaactgtcaaccgaatcggtcaccccaccgattcacggtccaaccgaccgatccggtctgattttcaaaactatgctactag |
217 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||| |||||||||| ||||||||||||||| || ||| ||||| ||||||||||||||||||||| |
|
|
T |
13178549 |
tgatagcatgaccgatccaaactgtcaaccgaaccggccaccccaccggttcacggtccaaccggccagtccagtctggttttcaaaactatgctactag |
13178648 |
T |
 |
Q |
218 |
tgctctagcatttacatgcaagacatctgctttt |
251 |
Q |
|
|
|||||||| |||||| || ||||||||||||||| |
|
|
T |
13178649 |
tgctctagtatttacttggaagacatctgctttt |
13178682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 73 - 210
Target Start/End: Complemental strand, 24067455 - 24067318
Alignment:
Q |
73 |
cggttttaaacgagtttttccggttcacgtcggttcatatcgatttgatagcatgaccgatccaaactgtcaaccgaatcggtcaccccaccgattcacg |
172 |
Q |
|
|
||||||||| ||||||| ||||||||| | |||||| | || ||| | ||||||||||| ||| ||||||||||| |||| ||||| ||| |||||| |
|
|
T |
24067455 |
cggttttaaccgagtttgtccggttcatgccggttctcaccggtttaaatgcatgaccgattcaatatgtcaaccgaaccggttacccctccggttcacg |
24067356 |
T |
 |
Q |
173 |
gtccaaccgaccgatccggtctgattttcaaaactatg |
210 |
Q |
|
|
|| | |||| ||| ||||||| |||||||||||||||| |
|
|
T |
24067355 |
gttcgaccggccggtccggtccgattttcaaaactatg |
24067318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 58 - 175
Target Start/End: Complemental strand, 22350632 - 22350515
Alignment:
Q |
58 |
aaaccgccggttcgccggttttaaacgagtttttccggttcacgtcggttcatatcgatttgatagcatgaccgatccaaactgtcaaccgaatcggtca |
157 |
Q |
|
|
||||||| |||| || |||||||| ||||||| || | |||| | ||||| | |||||| | ||||||||||||||| ||||||||||| |||| | |
|
|
T |
22350632 |
aaaccgctggtttgcaggttttaaccgagtttgtctgattcatgctggttctcaccgatttaaatgcatgaccgatccaatatgtcaaccgaaccggtta |
22350533 |
T |
 |
Q |
158 |
ccccaccgattcacggtc |
175 |
Q |
|
|
|||| ||| ||||||||| |
|
|
T |
22350532 |
cccctccggttcacggtc |
22350515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 211 - 251
Target Start/End: Original strand, 13203738 - 13203778
Alignment:
Q |
211 |
ctactagtgctctagcatttacatgcaagacatctgctttt |
251 |
Q |
|
|
|||||||||||||||| | ||||| |||||||||||||||| |
|
|
T |
13203738 |
ctactagtgctctagcttgtacattcaagacatctgctttt |
13203778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 59; Significance: 4e-25; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 58 - 176
Target Start/End: Complemental strand, 10258475 - 10258357
Alignment:
Q |
58 |
aaaccgccggttcgccggttttaaacgagtttttccggttcacgtcggttcatatcgatttgatagcatgaccgatccaaactgtcaaccgaatcggtca |
157 |
Q |
|
|
|||||||||||||||||||||||| ||||||||||||||||| | |||||| |||| ||| | ||||||||||||||| ||||||||||| |||| | |
|
|
T |
10258475 |
aaaccgccggttcgccggttttaaccgagtttttccggttcatgccggttctcatcggtttaaatgcatgaccgatccaatatgtcaaccgaaccggtta |
10258376 |
T |
 |
Q |
158 |
ccccaccgattcacggtcc |
176 |
Q |
|
|
|||| ||| |||||||||| |
|
|
T |
10258375 |
cccctccggttcacggtcc |
10258357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 40 - 175
Target Start/End: Complemental strand, 2848673 - 2848538
Alignment:
Q |
40 |
taacccggttggcccagaaaaccgccggttcgccggttttaaacgagtttttccggttcacgtcggttcatatcgatttgatagcatgaccgatccaaac |
139 |
Q |
|
|
||||||||||||| || ||||||||||||| |||||||||| ||||||| ||||||||| | |||||| | || |||||| |||||| |||||||| |
|
|
T |
2848673 |
taacccggttggctcattaaaccgccggttcaccggttttaaccgagtttgtccggttcatgccggttcgcaccggtttgattgcatgatcgatccaaca |
2848574 |
T |
 |
Q |
140 |
tgtcaaccgaatcggtcaccccaccgattcacggtc |
175 |
Q |
|
|
|| |||||||| |||| ||||| ||| ||||||||| |
|
|
T |
2848573 |
tgccaaccgaaccggttacccctccggttcacggtc |
2848538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 58 - 175
Target Start/End: Original strand, 33635715 - 33635832
Alignment:
Q |
58 |
aaaccgccggttcgccggttttaaacgagtttttccggttcacgtcggttcatatcgatttgatagcatgaccgatccaaactgtcaaccgaatcggtca |
157 |
Q |
|
|
||||||| |||||||||||||||| ||||||||||| ||||| | |||||| | || ||| | ||||||||||||||| ||||||||||| |||| | |
|
|
T |
33635715 |
aaaccgctggttcgccggttttaaccgagtttttccagttcatgccggttctcaccggtttaaatgcatgaccgatccaatatgtcaaccgaaccggtta |
33635814 |
T |
 |
Q |
158 |
ccccaccgattcacggtc |
175 |
Q |
|
|
|||| ||||||||||||| |
|
|
T |
33635815 |
cccctccgattcacggtc |
33635832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 52; Significance: 6e-21; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 40 - 175
Target Start/End: Original strand, 30361162 - 30361297
Alignment:
Q |
40 |
taacccggttggcccagaaaaccgccggttcgccggttttaaacgagtttttccggttcacgtcggttcatatcgatttgatagcatgaccgatccaaac |
139 |
Q |
|
|
||||||||||||| || ||||||||||||| ||| |||||| ||||||| ||||||||| | |||||| | || |||||| ||||||||||||||| |
|
|
T |
30361162 |
taacccggttggctcattaaaccgccggttcaccgattttaaccgagtttgtccggttcatgccggttcgcaccggtttgattgcatgaccgatccaaca |
30361261 |
T |
 |
Q |
140 |
tgtcaaccgaatcggtcaccccaccgattcacggtc |
175 |
Q |
|
|
|| |||||||| |||| || || ||||||||||||| |
|
|
T |
30361262 |
tgccaaccgaaccggttactcctccgattcacggtc |
30361297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 40 - 137
Target Start/End: Original strand, 14910794 - 14910891
Alignment:
Q |
40 |
taacccggttggcccagaaaaccgccggttcgccggttttaaacgagtttttccggttcacgtcggttcatatcgatttgatagcatgaccgatccaa |
137 |
Q |
|
|
|||| |||||||| || ||||||||||||| |||||||||| ||||||| ||||||||| | |||||| | || |||||| ||||||||||||||| |
|
|
T |
14910794 |
taactcggttggctcattaaaccgccggttcaccggttttaaccgagtttgtccggttcatgccggttcgcaccggtttgattgcatgaccgatccaa |
14910891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 30 - 99
Target Start/End: Complemental strand, 38968036 - 38967967
Alignment:
Q |
30 |
aaaaaagcaataacccggttggcccagaaaaccgccggttcgccggttttaaacgagtttttccggttca |
99 |
Q |
|
|
||||||||||||||||||||||| | ||||||||||||||||||||||| ||| |||| ||||||||| |
|
|
T |
38968036 |
aaaaaagcaataacccggttggctctcaaaaccgccggttcgccggtttttcacgggtttgtccggttca |
38967967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 58 - 107
Target Start/End: Complemental strand, 19725979 - 19725930
Alignment:
Q |
58 |
aaaccgccggttcgccggttttaaacgagtttttccggttcacgtcggtt |
107 |
Q |
|
|
|||||||||||||||||||||||| ||| |||||||||||| | |||||| |
|
|
T |
19725979 |
aaaccgccggttcgccggttttaaccgaatttttccggttctcatcggtt |
19725930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 52; Significance: 6e-21; HSPs: 7)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 40 - 175
Target Start/End: Complemental strand, 11733658 - 11733523
Alignment:
Q |
40 |
taacccggttggcccagaaaaccgccggttcgccggttttaaacgagtttttccggttcacgtcggttcatatcgatttgatagcatgaccgatccaaac |
139 |
Q |
|
|
||||||||||||| || ||||||||||||| |||||||||| ||||||| ||||||||| | |||||| | || |||||| |||||||| |||||| |
|
|
T |
11733658 |
taacccggttggctcattaaaccgccggttcaccggttttaaccgagtttgtccggttcatgccggttcgcaccggtttgattgcatgaccaatccaaca |
11733559 |
T |
 |
Q |
140 |
tgtcaaccgaatcggtcaccccaccgattcacggtc |
175 |
Q |
|
|
|| |||||||| |||| ||||| ||| ||||||||| |
|
|
T |
11733558 |
tgccaaccgaaccggttacccctccggttcacggtc |
11733523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 58 - 175
Target Start/End: Original strand, 47424293 - 47424410
Alignment:
Q |
58 |
aaaccgccggttcgccggttttaaacgagtttttccggttcacgtcggttcatatcgatttgatagcatgaccgatccaaactgtcaaccgaatcggtca |
157 |
Q |
|
|
||||||||||||| |||||||||||| ||||| ||||||||| | |||||| | || ||| | ||||||||||||||| ||||||||||| |||| | |
|
|
T |
47424293 |
aaaccgccggttcaccggttttaaacaagtttgtccggttcatgccggttctcaccggtttaaatgcatgaccgatccaatatgtcaaccgaaccggtta |
47424392 |
T |
 |
Q |
158 |
ccccaccgattcacggtc |
175 |
Q |
|
|
|| | |||||||| |||| |
|
|
T |
47424393 |
cctctccgattcatggtc |
47424410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 58 - 175
Target Start/End: Original strand, 47424560 - 47424677
Alignment:
Q |
58 |
aaaccgccggttcgccggttttaaacgagtttttccggttcacgtcggttcatatcgatttgatagcatgaccgatccaaactgtcaaccgaatcggtca |
157 |
Q |
|
|
|||||| |||||| |||||||||||| ||||| ||||||||| | |||||| | || ||| | ||||||||||||||| ||||||||||| |||| | |
|
|
T |
47424560 |
aaaccgtcggttcaccggttttaaacaagtttgtccggttcatgccggttctcaccggtttaaatgcatgaccgatccaatatgtcaaccgaaccggtta |
47424659 |
T |
 |
Q |
158 |
ccccaccgattcacggtc |
175 |
Q |
|
|
|||| |||||||| |||| |
|
|
T |
47424660 |
cccctccgattcatggtc |
47424677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 73 - 175
Target Start/End: Original strand, 36858985 - 36859087
Alignment:
Q |
73 |
cggttttaaacgagtttttccggttcacgtcggttcatatcgatttgatagcatgaccgatccaaactgtcaaccgaatcggtcaccccaccgattcacg |
172 |
Q |
|
|
||||||||| ||||||||||||||||| | |||||| | || ||| | ||||||||||||||| ||||||||||| |||| ||||| ||| |||||| |
|
|
T |
36858985 |
cggttttaaccgagtttttccggttcatgccggttctcaccggtttaaatgcatgaccgatccaatatgtcaaccgaaccggttacccctccggttcacg |
36859084 |
T |
 |
Q |
173 |
gtc |
175 |
Q |
|
|
||| |
|
|
T |
36859085 |
gtc |
36859087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 70 - 175
Target Start/End: Original strand, 29984090 - 29984195
Alignment:
Q |
70 |
cgccggttttaaacgagtttttccggttcacgtcggttcatatcgatttgatagcatgaccgatccaaactgtcaaccgaatcggtcaccccaccgattc |
169 |
Q |
|
|
|||||||||||| ||||||||||| ||||| | |||||| | || ||| | ||||||||||||||| ||||||||||| |||| ||||| ||| ||| |
|
|
T |
29984090 |
cgccggttttaatcgagtttttccagttcatgccggttctcaccggtttaaatgcatgaccgatccaatatgtcaaccgaaccggttacccctccggttc |
29984189 |
T |
 |
Q |
170 |
acggtc |
175 |
Q |
|
|
|||||| |
|
|
T |
29984190 |
acggtc |
29984195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 171 - 214
Target Start/End: Complemental strand, 14801321 - 14801278
Alignment:
Q |
171 |
cggtccaaccgaccgatccggtctgattttcaaaactatgctac |
214 |
Q |
|
|
|||| |||||| ||||||||||| |||||||||||||||||||| |
|
|
T |
14801321 |
cggttcaaccggccgatccggtccgattttcaaaactatgctac |
14801278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 171 - 214
Target Start/End: Complemental strand, 15248313 - 15248270
Alignment:
Q |
171 |
cggtccaaccgaccgatccggtctgattttcaaaactatgctac |
214 |
Q |
|
|
|||| |||||| ||||||||||| |||||||||||||||||||| |
|
|
T |
15248313 |
cggttcaaccggccgatccggtccgattttcaaaactatgctac |
15248270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 58 - 175
Target Start/End: Complemental strand, 8760369 - 8760252
Alignment:
Q |
58 |
aaaccgccggttcgccggttttaaacgagtttttccggttcacgtcggttcatatcgatttgatagcatgaccgatccaaactgtcaaccgaatcggtca |
157 |
Q |
|
|
|||||||||||||||||||||||| ||||||| |||| |||| | |||||| | || ||| | ||||||||||||||| ||||||||||| |||| | |
|
|
T |
8760369 |
aaaccgccggttcgccggttttaaccgagtttgtccgattcatgccggttctcaccggtttaaatgcatgaccgatccaatatgtcaaccgaaccggtta |
8760270 |
T |
 |
Q |
158 |
ccccaccgattcacggtc |
175 |
Q |
|
|
|||| ||| ||||||||| |
|
|
T |
8760269 |
cccctccggttcacggtc |
8760252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 46; Significance: 2e-17; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 40 - 210
Target Start/End: Complemental strand, 46534681 - 46534515
Alignment:
Q |
40 |
taacccggttggcccagaaaaccgccggttcgccggttttaaacgagtttttccggttcacgtcggttcatatcgatttgatagcatgaccgatccaaac |
139 |
Q |
|
|
||||||||||||| || |||||| |||||| ||| |||||| ||||||| ||||||||| | |||||| ||| |||||| ||||||||||||||| |
|
|
T |
46534681 |
taacccggttggctcattaaaccgtcggttcaccgattttaaccgagtttgtccggttcatgccggttcgcatcagtttgattgcatgaccgatccaaca |
46534582 |
T |
 |
Q |
140 |
tgtcaaccgaatcggtcaccccaccgattcacggtccaaccgaccgatccggtctgattttcaaaactatg |
210 |
Q |
|
|
| |||||||| |||| ||| | ||| |||||||| | ||||||||||||| | |||||||||||||| |
|
|
T |
46534581 |
taccaaccgaaccggttacctctccggttcacggt----cggaccgatccggtccggttttcaaaactatg |
46534515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 70 - 210
Target Start/End: Original strand, 9294455 - 9294595
Alignment:
Q |
70 |
cgccggttttaaacgagtttttccggttcacgtcggttcatatcgatttgatagcatgaccgatccaaactgtcaaccgaatcggtcaccccaccgattc |
169 |
Q |
|
|
|||||||||||| ||||||||||||||||| | |||||| | || ||| | ||||||||||||||| | ||||||||| || | ||||| ||| ||| |
|
|
T |
9294455 |
cgccggttttaaccgagtttttccggttcatgccggttctcaccggtttaaatgcatgaccgatccaatatttcaaccgaaccgattacccctccggttc |
9294554 |
T |
 |
Q |
170 |
acggtccaaccgaccgatccggtctgattttcaaaactatg |
210 |
Q |
|
|
|||||| |||| ||| ||||||| | |||||||||||||| |
|
|
T |
9294555 |
acggtcggaccggccggtccggtccggttttcaaaactatg |
9294595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 64 - 175
Target Start/End: Original strand, 12793506 - 12793617
Alignment:
Q |
64 |
ccggttcgccggttttaaacgagtttttccggttcacgtcggttcatatcgatttgatagcatgaccgatccaaactgtcaaccgaatcggtcaccccac |
163 |
Q |
|
|
|||||||||||||||||| ||||||||||||||||| | |||||| | || ||| | ||||||||||||||| ||||||||||| | || ||||| | |
|
|
T |
12793506 |
ccggttcgccggttttaaccgagtttttccggttcatgccggttctcaccggtttaaatgcatgaccgatccaatatgtcaaccgaaccagttacccctc |
12793605 |
T |
 |
Q |
164 |
cgattcacggtc |
175 |
Q |
|
|
| ||||||||| |
|
|
T |
12793606 |
cagttcacggtc |
12793617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 45; Significance: 1e-16; HSPs: 5)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 39 - 175
Target Start/End: Complemental strand, 29523302 - 29523166
Alignment:
Q |
39 |
ataacccggttggcccagaaaaccgccggttcgccggttttaaacgagtttttccggttcacgtcggttcatatcgatttgatagcatgaccgatccaaa |
138 |
Q |
|
|
|||||| ||||||| || ||||||||||||| |||||||||| ||||||| ||||||||| | |||||| | || |||||| ||||||||||||||| |
|
|
T |
29523302 |
ataacctggttggctcattaaaccgccggttcaccggttttaaccgagtttgtccggttcatgccggttcgcaccggtttgattgcatgaccgatccaac |
29523203 |
T |
 |
Q |
139 |
ctgtcaaccgaatcggtcaccccaccgattcacggtc |
175 |
Q |
|
|
| |||||||| |||| |||| ||| ||||||||| |
|
|
T |
29523202 |
ataccaaccgaaccggttacccatccggttcacggtc |
29523166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 40 - 175
Target Start/End: Complemental strand, 39061339 - 39061205
Alignment:
Q |
40 |
taacccggttggcccagaaaaccgccggttcgccggttttaaacgagtttttccggttcacgtcggttcatatcgatttgatagcatgaccgatccaaac |
139 |
Q |
|
|
||||||||||||| || ||||||||||||| |||||||||| ||| ||| ||||||||| | |||||| | || ||| || ||||||||||||||| |
|
|
T |
39061339 |
taacccggttggctcattaaaccgccggttcaccggttttaaccgaatttgtccggttcatgccggttcgcaccggttt-attgcatgaccgatccaaca |
39061241 |
T |
 |
Q |
140 |
tgtcaaccgaatcggtcaccccaccgattcacggtc |
175 |
Q |
|
|
|| |||||||| |||| ||||| ||| ||||||||| |
|
|
T |
39061240 |
tgccaaccgaaccggttacccctccggttcacggtc |
39061205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 58 - 175
Target Start/End: Original strand, 18541400 - 18541517
Alignment:
Q |
58 |
aaaccgccggttcgccggttttaaacgagtttttccggttcacgtcggttcatatcgatttgatagcatgaccgatccaaactgtcaaccgaatcggtca |
157 |
Q |
|
|
|||||| ||||||||||||||||| ||||||| ||||||||| |||||| | || ||| | ||||||||||||||| | ||||||||| |||| | |
|
|
T |
18541400 |
aaaccgtcggttcgccggttttaaccgagtttgtccggttcataccggttcgcaccggtttaaatgcatgaccgatccaatatatcaaccgaaccggtta |
18541499 |
T |
 |
Q |
158 |
ccccaccgattcacggtc |
175 |
Q |
|
|
|||| ||| ||||||||| |
|
|
T |
18541500 |
cccctccggttcacggtc |
18541517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 70 - 175
Target Start/End: Original strand, 7154280 - 7154385
Alignment:
Q |
70 |
cgccggttttaaacgagtttttccggttcacgtcggttcatatcgatttgatagcatgaccgatccaaactgtcaaccgaatcggtcaccccaccgattc |
169 |
Q |
|
|
|||||||||||| | |||||||||| |||| | |||||| | || ||| | ||||||||||||||| ||||||||||| |||| ||||| ||| ||| |
|
|
T |
7154280 |
cgccggttttaaccaagtttttccgattcatgccggttctcaccggtttaaatgcatgaccgatccaatatgtcaaccgaaccggttacccctccggttc |
7154379 |
T |
 |
Q |
170 |
acggtc |
175 |
Q |
|
|
|||||| |
|
|
T |
7154380 |
acggtc |
7154385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 64 - 175
Target Start/End: Original strand, 31901708 - 31901819
Alignment:
Q |
64 |
ccggttcgccggttttaaacgagtttttccggttcacgtcggttcatatcgatttgatagcatgaccgatccaaactgtcaaccgaatcggtcaccccac |
163 |
Q |
|
|
|||||||||||||||||| | ||||| ||||||||| | |||||| | || ||| | ||||||||||||||| ||||||||||| || | | ||| | |
|
|
T |
31901708 |
ccggttcgccggttttaaccaagtttgtccggttcatgccggttctcaccggtttaaatgcatgaccgatccaatatgtcaaccgaaccgattatccctc |
31901807 |
T |
 |
Q |
164 |
cgattcacggtc |
175 |
Q |
|
|
|| ||||||||| |
|
|
T |
31901808 |
cggttcacggtc |
31901819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University