View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0917_high_35 (Length: 251)

Name: NF0917_high_35
Description: NF0917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0917_high_35
NF0917_high_35
[»] chr6 (4 HSPs)
chr6 (118-251)||(13178549-13178682)
chr6 (73-210)||(24067318-24067455)
chr6 (58-175)||(22350515-22350632)
chr6 (211-251)||(13203738-13203778)
[»] chr3 (3 HSPs)
chr3 (58-176)||(10258357-10258475)
chr3 (40-175)||(2848538-2848673)
chr3 (58-175)||(33635715-33635832)
[»] chr8 (4 HSPs)
chr8 (40-175)||(30361162-30361297)
chr8 (40-137)||(14910794-14910891)
chr8 (30-99)||(38967967-38968036)
chr8 (58-107)||(19725930-19725979)
[»] chr7 (7 HSPs)
chr7 (40-175)||(11733523-11733658)
chr7 (58-175)||(47424293-47424410)
chr7 (58-175)||(47424560-47424677)
chr7 (73-175)||(36858985-36859087)
chr7 (70-175)||(29984090-29984195)
chr7 (171-214)||(14801278-14801321)
chr7 (171-214)||(15248270-15248313)
[»] chr5 (1 HSPs)
chr5 (58-175)||(8760252-8760369)
[»] chr1 (3 HSPs)
chr1 (40-210)||(46534515-46534681)
chr1 (70-210)||(9294455-9294595)
chr1 (64-175)||(12793506-12793617)
[»] chr2 (5 HSPs)
chr2 (39-175)||(29523166-29523302)
chr2 (40-175)||(39061205-39061339)
chr2 (58-175)||(18541400-18541517)
chr2 (70-175)||(7154280-7154385)
chr2 (64-175)||(31901708-31901819)


Alignment Details
Target: chr6 (Bit Score: 90; Significance: 1e-43; HSPs: 4)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 118 - 251
Target Start/End: Original strand, 13178549 - 13178682
Alignment:
118 tgatagcatgaccgatccaaactgtcaaccgaatcggtcaccccaccgattcacggtccaaccgaccgatccggtctgattttcaaaactatgctactag 217  Q
    ||||||||||||||||||||||||||||||||| ||| |||||||||| ||||||||||||||| ||  ||| ||||| |||||||||||||||||||||    
13178549 tgatagcatgaccgatccaaactgtcaaccgaaccggccaccccaccggttcacggtccaaccggccagtccagtctggttttcaaaactatgctactag 13178648  T
218 tgctctagcatttacatgcaagacatctgctttt 251  Q
    |||||||| |||||| || |||||||||||||||    
13178649 tgctctagtatttacttggaagacatctgctttt 13178682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 73 - 210
Target Start/End: Complemental strand, 24067455 - 24067318
Alignment:
73 cggttttaaacgagtttttccggttcacgtcggttcatatcgatttgatagcatgaccgatccaaactgtcaaccgaatcggtcaccccaccgattcacg 172  Q
    ||||||||| ||||||| ||||||||| | ||||||  | || ||| |  ||||||||||| |||  ||||||||||| |||| ||||| ||| ||||||    
24067455 cggttttaaccgagtttgtccggttcatgccggttctcaccggtttaaatgcatgaccgattcaatatgtcaaccgaaccggttacccctccggttcacg 24067356  T
173 gtccaaccgaccgatccggtctgattttcaaaactatg 210  Q
    || | |||| ||| ||||||| ||||||||||||||||    
24067355 gttcgaccggccggtccggtccgattttcaaaactatg 24067318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 58 - 175
Target Start/End: Complemental strand, 22350632 - 22350515
Alignment:
58 aaaccgccggttcgccggttttaaacgagtttttccggttcacgtcggttcatatcgatttgatagcatgaccgatccaaactgtcaaccgaatcggtca 157  Q
    ||||||| |||| || |||||||| ||||||| || | |||| |  |||||  | |||||| |  |||||||||||||||  ||||||||||| |||| |    
22350632 aaaccgctggtttgcaggttttaaccgagtttgtctgattcatgctggttctcaccgatttaaatgcatgaccgatccaatatgtcaaccgaaccggtta 22350533  T
158 ccccaccgattcacggtc 175  Q
    |||| ||| |||||||||    
22350532 cccctccggttcacggtc 22350515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 211 - 251
Target Start/End: Original strand, 13203738 - 13203778
Alignment:
211 ctactagtgctctagcatttacatgcaagacatctgctttt 251  Q
    |||||||||||||||| | ||||| ||||||||||||||||    
13203738 ctactagtgctctagcttgtacattcaagacatctgctttt 13203778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 59; Significance: 4e-25; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 58 - 176
Target Start/End: Complemental strand, 10258475 - 10258357
Alignment:
58 aaaccgccggttcgccggttttaaacgagtttttccggttcacgtcggttcatatcgatttgatagcatgaccgatccaaactgtcaaccgaatcggtca 157  Q
    |||||||||||||||||||||||| ||||||||||||||||| | ||||||  |||| ||| |  |||||||||||||||  ||||||||||| |||| |    
10258475 aaaccgccggttcgccggttttaaccgagtttttccggttcatgccggttctcatcggtttaaatgcatgaccgatccaatatgtcaaccgaaccggtta 10258376  T
158 ccccaccgattcacggtcc 176  Q
    |||| ||| ||||||||||    
10258375 cccctccggttcacggtcc 10258357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 40 - 175
Target Start/End: Complemental strand, 2848673 - 2848538
Alignment:
40 taacccggttggcccagaaaaccgccggttcgccggttttaaacgagtttttccggttcacgtcggttcatatcgatttgatagcatgaccgatccaaac 139  Q
    ||||||||||||| ||  ||||||||||||| |||||||||| ||||||| ||||||||| | ||||||  | || |||||| |||||| ||||||||      
2848673 taacccggttggctcattaaaccgccggttcaccggttttaaccgagtttgtccggttcatgccggttcgcaccggtttgattgcatgatcgatccaaca 2848574  T
140 tgtcaaccgaatcggtcaccccaccgattcacggtc 175  Q
    || |||||||| |||| ||||| ||| |||||||||    
2848573 tgccaaccgaaccggttacccctccggttcacggtc 2848538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 58 - 175
Target Start/End: Original strand, 33635715 - 33635832
Alignment:
58 aaaccgccggttcgccggttttaaacgagtttttccggttcacgtcggttcatatcgatttgatagcatgaccgatccaaactgtcaaccgaatcggtca 157  Q
    ||||||| |||||||||||||||| ||||||||||| ||||| | ||||||  | || ||| |  |||||||||||||||  ||||||||||| |||| |    
33635715 aaaccgctggttcgccggttttaaccgagtttttccagttcatgccggttctcaccggtttaaatgcatgaccgatccaatatgtcaaccgaaccggtta 33635814  T
158 ccccaccgattcacggtc 175  Q
    |||| |||||||||||||    
33635815 cccctccgattcacggtc 33635832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 52; Significance: 6e-21; HSPs: 4)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 40 - 175
Target Start/End: Original strand, 30361162 - 30361297
Alignment:
40 taacccggttggcccagaaaaccgccggttcgccggttttaaacgagtttttccggttcacgtcggttcatatcgatttgatagcatgaccgatccaaac 139  Q
    ||||||||||||| ||  ||||||||||||| ||| |||||| ||||||| ||||||||| | ||||||  | || |||||| |||||||||||||||      
30361162 taacccggttggctcattaaaccgccggttcaccgattttaaccgagtttgtccggttcatgccggttcgcaccggtttgattgcatgaccgatccaaca 30361261  T
140 tgtcaaccgaatcggtcaccccaccgattcacggtc 175  Q
    || |||||||| |||| || || |||||||||||||    
30361262 tgccaaccgaaccggttactcctccgattcacggtc 30361297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 40 - 137
Target Start/End: Original strand, 14910794 - 14910891
Alignment:
40 taacccggttggcccagaaaaccgccggttcgccggttttaaacgagtttttccggttcacgtcggttcatatcgatttgatagcatgaccgatccaa 137  Q
    |||| |||||||| ||  ||||||||||||| |||||||||| ||||||| ||||||||| | ||||||  | || |||||| |||||||||||||||    
14910794 taactcggttggctcattaaaccgccggttcaccggttttaaccgagtttgtccggttcatgccggttcgcaccggtttgattgcatgaccgatccaa 14910891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 30 - 99
Target Start/End: Complemental strand, 38968036 - 38967967
Alignment:
30 aaaaaagcaataacccggttggcccagaaaaccgccggttcgccggttttaaacgagtttttccggttca 99  Q
    ||||||||||||||||||||||| |  |||||||||||||||||||||||  ||| |||| |||||||||    
38968036 aaaaaagcaataacccggttggctctcaaaaccgccggttcgccggtttttcacgggtttgtccggttca 38967967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 58 - 107
Target Start/End: Complemental strand, 19725979 - 19725930
Alignment:
58 aaaccgccggttcgccggttttaaacgagtttttccggttcacgtcggtt 107  Q
    |||||||||||||||||||||||| ||| |||||||||||| | ||||||    
19725979 aaaccgccggttcgccggttttaaccgaatttttccggttctcatcggtt 19725930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 52; Significance: 6e-21; HSPs: 7)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 40 - 175
Target Start/End: Complemental strand, 11733658 - 11733523
Alignment:
40 taacccggttggcccagaaaaccgccggttcgccggttttaaacgagtttttccggttcacgtcggttcatatcgatttgatagcatgaccgatccaaac 139  Q
    ||||||||||||| ||  ||||||||||||| |||||||||| ||||||| ||||||||| | ||||||  | || |||||| |||||||| ||||||      
11733658 taacccggttggctcattaaaccgccggttcaccggttttaaccgagtttgtccggttcatgccggttcgcaccggtttgattgcatgaccaatccaaca 11733559  T
140 tgtcaaccgaatcggtcaccccaccgattcacggtc 175  Q
    || |||||||| |||| ||||| ||| |||||||||    
11733558 tgccaaccgaaccggttacccctccggttcacggtc 11733523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 58 - 175
Target Start/End: Original strand, 47424293 - 47424410
Alignment:
58 aaaccgccggttcgccggttttaaacgagtttttccggttcacgtcggttcatatcgatttgatagcatgaccgatccaaactgtcaaccgaatcggtca 157  Q
    ||||||||||||| |||||||||||| ||||| ||||||||| | ||||||  | || ||| |  |||||||||||||||  ||||||||||| |||| |    
47424293 aaaccgccggttcaccggttttaaacaagtttgtccggttcatgccggttctcaccggtttaaatgcatgaccgatccaatatgtcaaccgaaccggtta 47424392  T
158 ccccaccgattcacggtc 175  Q
    || | |||||||| ||||    
47424393 cctctccgattcatggtc 47424410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 58 - 175
Target Start/End: Original strand, 47424560 - 47424677
Alignment:
58 aaaccgccggttcgccggttttaaacgagtttttccggttcacgtcggttcatatcgatttgatagcatgaccgatccaaactgtcaaccgaatcggtca 157  Q
    |||||| |||||| |||||||||||| ||||| ||||||||| | ||||||  | || ||| |  |||||||||||||||  ||||||||||| |||| |    
47424560 aaaccgtcggttcaccggttttaaacaagtttgtccggttcatgccggttctcaccggtttaaatgcatgaccgatccaatatgtcaaccgaaccggtta 47424659  T
158 ccccaccgattcacggtc 175  Q
    |||| |||||||| ||||    
47424660 cccctccgattcatggtc 47424677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 73 - 175
Target Start/End: Original strand, 36858985 - 36859087
Alignment:
73 cggttttaaacgagtttttccggttcacgtcggttcatatcgatttgatagcatgaccgatccaaactgtcaaccgaatcggtcaccccaccgattcacg 172  Q
    ||||||||| ||||||||||||||||| | ||||||  | || ||| |  |||||||||||||||  ||||||||||| |||| ||||| ||| ||||||    
36858985 cggttttaaccgagtttttccggttcatgccggttctcaccggtttaaatgcatgaccgatccaatatgtcaaccgaaccggttacccctccggttcacg 36859084  T
173 gtc 175  Q
    |||    
36859085 gtc 36859087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 70 - 175
Target Start/End: Original strand, 29984090 - 29984195
Alignment:
70 cgccggttttaaacgagtttttccggttcacgtcggttcatatcgatttgatagcatgaccgatccaaactgtcaaccgaatcggtcaccccaccgattc 169  Q
    |||||||||||| ||||||||||| ||||| | ||||||  | || ||| |  |||||||||||||||  ||||||||||| |||| ||||| ||| |||    
29984090 cgccggttttaatcgagtttttccagttcatgccggttctcaccggtttaaatgcatgaccgatccaatatgtcaaccgaaccggttacccctccggttc 29984189  T
170 acggtc 175  Q
    ||||||    
29984190 acggtc 29984195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 171 - 214
Target Start/End: Complemental strand, 14801321 - 14801278
Alignment:
171 cggtccaaccgaccgatccggtctgattttcaaaactatgctac 214  Q
    |||| |||||| ||||||||||| ||||||||||||||||||||    
14801321 cggttcaaccggccgatccggtccgattttcaaaactatgctac 14801278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 171 - 214
Target Start/End: Complemental strand, 15248313 - 15248270
Alignment:
171 cggtccaaccgaccgatccggtctgattttcaaaactatgctac 214  Q
    |||| |||||| ||||||||||| ||||||||||||||||||||    
15248313 cggttcaaccggccgatccggtccgattttcaaaactatgctac 15248270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 58 - 175
Target Start/End: Complemental strand, 8760369 - 8760252
Alignment:
58 aaaccgccggttcgccggttttaaacgagtttttccggttcacgtcggttcatatcgatttgatagcatgaccgatccaaactgtcaaccgaatcggtca 157  Q
    |||||||||||||||||||||||| ||||||| |||| |||| | ||||||  | || ||| |  |||||||||||||||  ||||||||||| |||| |    
8760369 aaaccgccggttcgccggttttaaccgagtttgtccgattcatgccggttctcaccggtttaaatgcatgaccgatccaatatgtcaaccgaaccggtta 8760270  T
158 ccccaccgattcacggtc 175  Q
    |||| ||| |||||||||    
8760269 cccctccggttcacggtc 8760252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 46; Significance: 2e-17; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 40 - 210
Target Start/End: Complemental strand, 46534681 - 46534515
Alignment:
40 taacccggttggcccagaaaaccgccggttcgccggttttaaacgagtttttccggttcacgtcggttcatatcgatttgatagcatgaccgatccaaac 139  Q
    ||||||||||||| ||  |||||| |||||| ||| |||||| ||||||| ||||||||| | ||||||  |||  |||||| |||||||||||||||      
46534681 taacccggttggctcattaaaccgtcggttcaccgattttaaccgagtttgtccggttcatgccggttcgcatcagtttgattgcatgaccgatccaaca 46534582  T
140 tgtcaaccgaatcggtcaccccaccgattcacggtccaaccgaccgatccggtctgattttcaaaactatg 210  Q
    |  |||||||| |||| ||| | ||| ||||||||    | ||||||||||||| | ||||||||||||||    
46534581 taccaaccgaaccggttacctctccggttcacggt----cggaccgatccggtccggttttcaaaactatg 46534515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 70 - 210
Target Start/End: Original strand, 9294455 - 9294595
Alignment:
70 cgccggttttaaacgagtttttccggttcacgtcggttcatatcgatttgatagcatgaccgatccaaactgtcaaccgaatcggtcaccccaccgattc 169  Q
    |||||||||||| ||||||||||||||||| | ||||||  | || ||| |  |||||||||||||||  | ||||||||| || | ||||| ||| |||    
9294455 cgccggttttaaccgagtttttccggttcatgccggttctcaccggtttaaatgcatgaccgatccaatatttcaaccgaaccgattacccctccggttc 9294554  T
170 acggtccaaccgaccgatccggtctgattttcaaaactatg 210  Q
    ||||||  |||| ||| ||||||| | ||||||||||||||    
9294555 acggtcggaccggccggtccggtccggttttcaaaactatg 9294595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 64 - 175
Target Start/End: Original strand, 12793506 - 12793617
Alignment:
64 ccggttcgccggttttaaacgagtttttccggttcacgtcggttcatatcgatttgatagcatgaccgatccaaactgtcaaccgaatcggtcaccccac 163  Q
    |||||||||||||||||| ||||||||||||||||| | ||||||  | || ||| |  |||||||||||||||  ||||||||||| | || ||||| |    
12793506 ccggttcgccggttttaaccgagtttttccggttcatgccggttctcaccggtttaaatgcatgaccgatccaatatgtcaaccgaaccagttacccctc 12793605  T
164 cgattcacggtc 175  Q
    |  |||||||||    
12793606 cagttcacggtc 12793617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 45; Significance: 1e-16; HSPs: 5)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 39 - 175
Target Start/End: Complemental strand, 29523302 - 29523166
Alignment:
39 ataacccggttggcccagaaaaccgccggttcgccggttttaaacgagtttttccggttcacgtcggttcatatcgatttgatagcatgaccgatccaaa 138  Q
    |||||| ||||||| ||  ||||||||||||| |||||||||| ||||||| ||||||||| | ||||||  | || |||||| |||||||||||||||     
29523302 ataacctggttggctcattaaaccgccggttcaccggttttaaccgagtttgtccggttcatgccggttcgcaccggtttgattgcatgaccgatccaac 29523203  T
139 ctgtcaaccgaatcggtcaccccaccgattcacggtc 175  Q
     |  |||||||| |||| ||||  ||| |||||||||    
29523202 ataccaaccgaaccggttacccatccggttcacggtc 29523166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 40 - 175
Target Start/End: Complemental strand, 39061339 - 39061205
Alignment:
40 taacccggttggcccagaaaaccgccggttcgccggttttaaacgagtttttccggttcacgtcggttcatatcgatttgatagcatgaccgatccaaac 139  Q
    ||||||||||||| ||  ||||||||||||| |||||||||| ||| ||| ||||||||| | ||||||  | || ||| || |||||||||||||||      
39061339 taacccggttggctcattaaaccgccggttcaccggttttaaccgaatttgtccggttcatgccggttcgcaccggttt-attgcatgaccgatccaaca 39061241  T
140 tgtcaaccgaatcggtcaccccaccgattcacggtc 175  Q
    || |||||||| |||| ||||| ||| |||||||||    
39061240 tgccaaccgaaccggttacccctccggttcacggtc 39061205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 58 - 175
Target Start/End: Original strand, 18541400 - 18541517
Alignment:
58 aaaccgccggttcgccggttttaaacgagtttttccggttcacgtcggttcatatcgatttgatagcatgaccgatccaaactgtcaaccgaatcggtca 157  Q
    |||||| ||||||||||||||||| ||||||| |||||||||   ||||||  | || ||| |  |||||||||||||||  | ||||||||| |||| |    
18541400 aaaccgtcggttcgccggttttaaccgagtttgtccggttcataccggttcgcaccggtttaaatgcatgaccgatccaatatatcaaccgaaccggtta 18541499  T
158 ccccaccgattcacggtc 175  Q
    |||| ||| |||||||||    
18541500 cccctccggttcacggtc 18541517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 70 - 175
Target Start/End: Original strand, 7154280 - 7154385
Alignment:
70 cgccggttttaaacgagtttttccggttcacgtcggttcatatcgatttgatagcatgaccgatccaaactgtcaaccgaatcggtcaccccaccgattc 169  Q
    |||||||||||| | |||||||||| |||| | ||||||  | || ||| |  |||||||||||||||  ||||||||||| |||| ||||| ||| |||    
7154280 cgccggttttaaccaagtttttccgattcatgccggttctcaccggtttaaatgcatgaccgatccaatatgtcaaccgaaccggttacccctccggttc 7154379  T
170 acggtc 175  Q
    ||||||    
7154380 acggtc 7154385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 64 - 175
Target Start/End: Original strand, 31901708 - 31901819
Alignment:
64 ccggttcgccggttttaaacgagtttttccggttcacgtcggttcatatcgatttgatagcatgaccgatccaaactgtcaaccgaatcggtcaccccac 163  Q
    |||||||||||||||||| | ||||| ||||||||| | ||||||  | || ||| |  |||||||||||||||  ||||||||||| || | | ||| |    
31901708 ccggttcgccggttttaaccaagtttgtccggttcatgccggttctcaccggtttaaatgcatgaccgatccaatatgtcaaccgaaccgattatccctc 31901807  T
164 cgattcacggtc 175  Q
    || |||||||||    
31901808 cggttcacggtc 31901819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University