View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0917_low_13 (Length: 466)
Name: NF0917_low_13
Description: NF0917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0917_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 4e-85; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 4e-85
Query Start/End: Original strand, 16 - 203
Target Start/End: Original strand, 6254789 - 6254976
Alignment:
| Q |
16 |
atactaatgattaatacaccacatcttaatccaaaatcatatcggtgaccactcttatctacggaaagacagtgtcatcatgaattctattactactaca |
115 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6254789 |
atactaatgattaatacaccacatctcaattcaaaatcatatcggtgaccactcttatctacggaaagactttgtcatcatgaattctattactactaca |
6254888 |
T |
|
| Q |
116 |
cttcgttctcattgtcaaatgagaccttaatgttgattaacaatctcaaagaaattttttgtttgtaggaaaaggtcaagatcatgga |
203 |
Q |
| |
|
||| ||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6254889 |
cttagttctcattatcaaatgagaccttaatgttgattaacgatctcaaagaaattttttgtttgtaggaaaaggtcaagatcatgga |
6254976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 123; E-Value: 5e-63
Query Start/End: Original strand, 268 - 402
Target Start/End: Original strand, 6255043 - 6255177
Alignment:
| Q |
268 |
tgctttagttgcaaaaagaccaggtaattgaagacggattgtccaaacaaacaacatggttcatctagttttgtattggatacaacaaatgggagaatga |
367 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6255043 |
tgctttagttgcaaaaagaccgggtaattgaagacggattgtccaaacaaacaacatggttcatctagttttgtattggatacaaaaaatgggagaatga |
6255142 |
T |
|
| Q |
368 |
ctattgtgcttatgctagaagttgtaatgatgttg |
402 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
6255143 |
ctattgtgcttatgctagaagttgtaatgacgttg |
6255177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 413 times since January 2019
Visitors: 6714