View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0917_low_15 (Length: 461)
Name: NF0917_low_15
Description: NF0917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0917_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 318; Significance: 1e-179; HSPs: 6)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 117 - 446
Target Start/End: Complemental strand, 13052830 - 13052501
Alignment:
| Q |
117 |
atgcgatggatcaactccatcattctacatttacaatctccctccacgtttcaaccttgacctactcaaaaactgcgaaaatctcaacatctacacaaat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13052830 |
atgcgatggatcaactccatcattctacatttacaatctccctccacgtttcaaccttgacctactcaaaaactgcgaaaatctcaacatctacacaaat |
13052731 |
T |
 |
| Q |
217 |
atgtgccctcatgtgaagaacaatggcttaggtcaacccctctcaaaaacattatggtacacaacacaccaattgttagcagaaatgattttccatgcta |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13052730 |
atgtgccctcatgtgaagaacaatggcttaggtcaacccctctcaaaaacatcatggtacacaacacaccaattgttagcagaaatgattttccatgcta |
13052631 |
T |
 |
| Q |
317 |
ggttagaaaatcacctgtgtcgcacgtgggatcctaatcaagcaattttattctatataccattctacggtggactacacgcgtcaagcatgttccgcga |
416 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
13052630 |
ggttagaaaatcacgtgtgtcgcacgtgggatcctaatcaagcaattttattctatataccattctatggtggactacacgcgtcaagcatgttccgcga |
13052531 |
T |
 |
| Q |
417 |
agcgaatcacactctccgcgactccttagc |
446 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
13052530 |
agcgaatcacactctccgcgactccttagc |
13052501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 69; E-Value: 9e-31
Query Start/End: Original strand, 117 - 185
Target Start/End: Complemental strand, 13042942 - 13042874
Alignment:
| Q |
117 |
atgcgatggatcaactccatcattctacatttacaatctccctccacgtttcaaccttgacctactcaa |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13042942 |
atgcgatggatcaactccatcattctacatttacaatctccctccacgtttcaaccttgacctactcaa |
13042874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 69; E-Value: 9e-31
Query Start/End: Original strand, 117 - 185
Target Start/End: Complemental strand, 13047833 - 13047765
Alignment:
| Q |
117 |
atgcgatggatcaactccatcattctacatttacaatctccctccacgtttcaaccttgacctactcaa |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13047833 |
atgcgatggatcaactccatcattctacatttacaatctccctccacgtttcaaccttgacctactcaa |
13047765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 29 - 70
Target Start/End: Complemental strand, 13043030 - 13042989
Alignment:
| Q |
29 |
tatgcctcttccttctttacttcatgtaccccaaaaccataa |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
13043030 |
tatgcctcttccttctttacttcatgtaccccacaaccataa |
13042989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 29 - 70
Target Start/End: Complemental strand, 13047915 - 13047874
Alignment:
| Q |
29 |
tatgcctcttccttctttacttcatgtaccccaaaaccataa |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
13047915 |
tatgcctcttccttctttacttcatgtaccccacaacaataa |
13047874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 29 - 70
Target Start/End: Complemental strand, 13052912 - 13052871
Alignment:
| Q |
29 |
tatgcctcttccttctttacttcatgtaccccaaaaccataa |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
13052912 |
tatgcctcttccttctttacttcatgtaccccacaacaataa |
13052871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University