View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0917_low_29 (Length: 353)

Name: NF0917_low_29
Description: NF0917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0917_low_29
NF0917_low_29
[»] chr7 (1 HSPs)
chr7 (27-307)||(32017030-32017310)
[»] chr5 (1 HSPs)
chr5 (33-76)||(919392-919435)
[»] chr6 (1 HSPs)
chr6 (36-86)||(26397728-26397778)
[»] chr8 (1 HSPs)
chr8 (36-76)||(27185603-27185643)
[»] chr2 (1 HSPs)
chr2 (43-87)||(8453176-8453220)


Alignment Details
Target: chr7 (Bit Score: 248; Significance: 1e-137; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 27 - 307
Target Start/End: Original strand, 32017030 - 32017310
Alignment:
27 tcaaaagatgtggaggagatggtggaagagatcaaggtgttgtcttggagatggatgttgatgagattgaaggttttgccttgcctattttactagtgga 126  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
32017030 tcaaaagatgtggaggagatggtggaagagatcaaggtgttgtcttggagatggatgttgatgagattgaaggttttgccttgcctattttacgagtgga 32017129  T
127 attgggatcctgaagattgcttaagaaggtagtatttaaggggggagggtctgtgtttttcgagctgtgctctctgggttggttcacagcaggttttgtt 226  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32017130 attgggatcctgaagattgcttaagaaggtagtatttaaggggggagggtctgtgtttttcgagctgtgctctctgggttggttcacagcaggttttgtt 32017229  T
227 ggtgttttcccctatgcggctgttctgctatctgtagtagtgctgctgtcttnnnnnnntgcggggagtgttgttttctgc 307  Q
    ||| ||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||| ||||    
32017230 ggttttttcccctatgcggctgttctgctatctgtagtagtgctgctgtcttgggggggtgcggggagtgttgtttactgc 32017310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 33 - 76
Target Start/End: Original strand, 919392 - 919435
Alignment:
33 gatgtggaggagatggtggaagagatcaaggtgttgtcttggag 76  Q
    |||||||| ||||| ||||| |||||||||||||||||||||||    
919392 gatgtggaagagatagtggaggagatcaaggtgttgtcttggag 919435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 36 - 86
Target Start/End: Original strand, 26397728 - 26397778
Alignment:
36 gtggaggagatggtggaagagatcaaggtgttgtcttggagatggatgttg 86  Q
    ||||| ||||| |||||||||||||||||  |||||||| |||||||||||    
26397728 gtggatgagatagtggaagagatcaaggtaatgtcttggcgatggatgttg 26397778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 36 - 76
Target Start/End: Complemental strand, 27185643 - 27185603
Alignment:
36 gtggaggagatggtggaagagatcaaggtgttgtcttggag 76  Q
    ||||| ||||| |||||||||||||||| ||||||||||||    
27185643 gtggatgagatagtggaagagatcaaggggttgtcttggag 27185603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 43 - 87
Target Start/End: Original strand, 8453176 - 8453220
Alignment:
43 agatggtggaagagatcaaggtgttgtcttggagatggatgttga 87  Q
    |||| ||||| ||| | ||||||||||||||||||||||||||||    
8453176 agattgtggaggaggtgaaggtgttgtcttggagatggatgttga 8453220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University