View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0917_low_29 (Length: 353)
Name: NF0917_low_29
Description: NF0917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0917_low_29 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 248; Significance: 1e-137; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 27 - 307
Target Start/End: Original strand, 32017030 - 32017310
Alignment:
| Q |
27 |
tcaaaagatgtggaggagatggtggaagagatcaaggtgttgtcttggagatggatgttgatgagattgaaggttttgccttgcctattttactagtgga |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32017030 |
tcaaaagatgtggaggagatggtggaagagatcaaggtgttgtcttggagatggatgttgatgagattgaaggttttgccttgcctattttacgagtgga |
32017129 |
T |
 |
| Q |
127 |
attgggatcctgaagattgcttaagaaggtagtatttaaggggggagggtctgtgtttttcgagctgtgctctctgggttggttcacagcaggttttgtt |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32017130 |
attgggatcctgaagattgcttaagaaggtagtatttaaggggggagggtctgtgtttttcgagctgtgctctctgggttggttcacagcaggttttgtt |
32017229 |
T |
 |
| Q |
227 |
ggtgttttcccctatgcggctgttctgctatctgtagtagtgctgctgtcttnnnnnnntgcggggagtgttgttttctgc |
307 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
32017230 |
ggttttttcccctatgcggctgttctgctatctgtagtagtgctgctgtcttgggggggtgcggggagtgttgtttactgc |
32017310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 33 - 76
Target Start/End: Original strand, 919392 - 919435
Alignment:
| Q |
33 |
gatgtggaggagatggtggaagagatcaaggtgttgtcttggag |
76 |
Q |
| |
|
|||||||| ||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
919392 |
gatgtggaagagatagtggaggagatcaaggtgttgtcttggag |
919435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 36 - 86
Target Start/End: Original strand, 26397728 - 26397778
Alignment:
| Q |
36 |
gtggaggagatggtggaagagatcaaggtgttgtcttggagatggatgttg |
86 |
Q |
| |
|
||||| ||||| ||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
26397728 |
gtggatgagatagtggaagagatcaaggtaatgtcttggcgatggatgttg |
26397778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 36 - 76
Target Start/End: Complemental strand, 27185643 - 27185603
Alignment:
| Q |
36 |
gtggaggagatggtggaagagatcaaggtgttgtcttggag |
76 |
Q |
| |
|
||||| ||||| |||||||||||||||| |||||||||||| |
|
|
| T |
27185643 |
gtggatgagatagtggaagagatcaaggggttgtcttggag |
27185603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 43 - 87
Target Start/End: Original strand, 8453176 - 8453220
Alignment:
| Q |
43 |
agatggtggaagagatcaaggtgttgtcttggagatggatgttga |
87 |
Q |
| |
|
|||| ||||| ||| | |||||||||||||||||||||||||||| |
|
|
| T |
8453176 |
agattgtggaggaggtgaaggtgttgtcttggagatggatgttga |
8453220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University