View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0917_low_30 (Length: 348)

Name: NF0917_low_30
Description: NF0917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0917_low_30
NF0917_low_30
[»] chr8 (2 HSPs)
chr8 (96-160)||(11152075-11152139)
chr8 (225-267)||(11152204-11152246)


Alignment Details
Target: chr8 (Bit Score: 61; Significance: 4e-26; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 96 - 160
Target Start/End: Original strand, 11152075 - 11152139
Alignment:
96 accatatgaaacaacgcatgtgaaacattgattaaacaatgtagtacaaatattgataggttata 160  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
11152075 accatatgaaacaacgcatgtgaaacattgattaagcaatgtagtacaaatattgataggttata 11152139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 225 - 267
Target Start/End: Original strand, 11152204 - 11152246
Alignment:
225 tactggatagccctagcacctctactaccccataccatgccta 267  Q
    |||||| ||||||||||||||||||||||||||||||||||||    
11152204 tactgggtagccctagcacctctactaccccataccatgccta 11152246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 724 times since January 2019
Visitors: 6719