View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0917_low_33 (Length: 339)
Name: NF0917_low_33
Description: NF0917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0917_low_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 243; Significance: 1e-135; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 60 - 331
Target Start/End: Complemental strand, 42394149 - 42393878
Alignment:
Q |
60 |
tcatagggaagccgaacttgtcggannnnnnncctgcgttggctcggtttgatttgcagggtattgtgaaagatatgaatcttttggtgcctcgttttga |
159 |
Q |
|
|
|||||||||||||||||||||| || |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42394149 |
tcatagggaagccgaacttgtcagatttttttcctgcgctggctcggtttgatttgcagggtattgtgaaagatatgaatcttttggtgcctcgttttga |
42394050 |
T |
 |
Q |
160 |
tggaatatttgaaaagatgattggtgaacgaatggtgaaggatgtagaaggaaaggagagtgaaagtaaggattttttgcagtttttgttgaatttgaag |
259 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42394049 |
tggaatatttgaaaagatgattggtgaacgaatggtgaaggatgtagaaggaaaggagagtgaaagtaaggattttttgcagtttttgttgaatttgaag |
42393950 |
T |
 |
Q |
260 |
gaggaaggtgattccaagacaccattcacaagcacccacgtgaaggctcttctcctggtatgctacctttgt |
331 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42393949 |
gaggaaggtgattccaagacaccattcacaagcacccacgtgaaggctcttctcctggtatgctacctttgt |
42393878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 65 - 331
Target Start/End: Complemental strand, 42378229 - 42377960
Alignment:
Q |
65 |
gggaagccgaacttgtcggannnnnnncctgcgttggctcggtttgatttgcagggtattgtgaaagatatgaatcttttggtgcctcgttttgatggaa |
164 |
Q |
|
|
||||||||||| |||||||| |||| |||||| |||||||||||||||||| ||||||||||||||||| |||||||||||| |||||||| | |
|
|
T |
42378229 |
gggaagccgaatttgtcggatttttttcctgggttggcccggtttgatttgcagggtgttgtgaaagatatgaatgctttggtgcctcgctttgatggga |
42378130 |
T |
 |
Q |
165 |
tatttgaaaagatgattggtgaacgaatggtgaaggatgtagaaggaaaggag---agtgaaagtaaggattttttgcagtttttgttgaatttgaagga |
261 |
Q |
|
|
||||||| |||||||||||||||||| || |||||| | || || |||||| | || |||| ||| ||| ||||||||||||||||||||||||| |
|
|
T |
42378129 |
tatttgagaagatgattggtgaacgattgaagaaggaagaggatgggaaggagaataatgggagtagggactttctgcagtttttgttgaatttgaagga |
42378030 |
T |
 |
Q |
262 |
ggaaggtgattccaagacaccattcacaagcacccacgtgaaggctcttctcctggtatgctacctttgt |
331 |
Q |
|
|
||| |||||||| |||||||| || |||| || || || |||||||| ||| ||||||||||| ||||| |
|
|
T |
42378029 |
ggagggtgattctaagacaccgtttacaaatactcatgttaaggctctactcatggtatgctacttttgt |
42377960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 566 times since January 2019
Visitors: 6704