View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0917_low_37 (Length: 321)

Name: NF0917_low_37
Description: NF0917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0917_low_37
NF0917_low_37
[»] chr5 (1 HSPs)
chr5 (100-295)||(10004171-10004366)


Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 100 - 295
Target Start/End: Complemental strand, 10004366 - 10004171
Alignment:
100 ctgcccagtctgagagtttagccaaattcaatttgaaagctattcaagataactcaccgtttaataaatatcttatcggcgaaaaggcagccctattttg 199  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
10004366 ctgcccagtctgagagtttagccaaattcaatttgaaagctattcaagataactcaccgtttaataaatatcttatcggcgaaaaggcagccctgttttg 10004267  T
200 tggtggtacgggaacccaaatatatatatggaacttagatgaatggggttcagagtgttgcctagagtggcatgacggattgaaaggtgggagttc 295  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10004266 tggtggtacgggaacccaaatatatatatggaacttggatgaatggggttcagagtgttgcctagagtggcatgacggattgaaaggtgggagttc 10004171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University