View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0917_low_37 (Length: 321)
Name: NF0917_low_37
Description: NF0917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0917_low_37 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 100 - 295
Target Start/End: Complemental strand, 10004366 - 10004171
Alignment:
Q |
100 |
ctgcccagtctgagagtttagccaaattcaatttgaaagctattcaagataactcaccgtttaataaatatcttatcggcgaaaaggcagccctattttg |
199 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
10004366 |
ctgcccagtctgagagtttagccaaattcaatttgaaagctattcaagataactcaccgtttaataaatatcttatcggcgaaaaggcagccctgttttg |
10004267 |
T |
 |
Q |
200 |
tggtggtacgggaacccaaatatatatatggaacttagatgaatggggttcagagtgttgcctagagtggcatgacggattgaaaggtgggagttc |
295 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10004266 |
tggtggtacgggaacccaaatatatatatggaacttggatgaatggggttcagagtgttgcctagagtggcatgacggattgaaaggtgggagttc |
10004171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University