View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0917_low_44 (Length: 309)

Name: NF0917_low_44
Description: NF0917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0917_low_44
NF0917_low_44
[»] chr6 (1 HSPs)
chr6 (63-230)||(217187-217349)


Alignment Details
Target: chr6 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 63 - 230
Target Start/End: Complemental strand, 217349 - 217187
Alignment:
63 tagggaaggtttcatctttgtacttgacaccattccacgtgtatgtcattgtgtgcatgtcaaattgggtaatatggcaatatttatggtggataacact 162  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
217349 taggggaggtttcatctttgtacttgacaccattccacgtgtatgtcattgtgtgcatgtcaaattgggtaatatagcaatatttatggtggataacact 217250  T
163 atgtcattgtattgtattgcttattgtcatggttttataagctttggttagtccatggtacaacttct 230  Q
    ||||||||||     |||||||||||||||||||||||||||||||||||||||||||||||||||||    
217249 atgtcattgt-----attgcttattgtcatggttttataagctttggttagtccatggtacaacttct 217187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University