View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0917_low_44 (Length: 309)
Name: NF0917_low_44
Description: NF0917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0917_low_44 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 63 - 230
Target Start/End: Complemental strand, 217349 - 217187
Alignment:
Q |
63 |
tagggaaggtttcatctttgtacttgacaccattccacgtgtatgtcattgtgtgcatgtcaaattgggtaatatggcaatatttatggtggataacact |
162 |
Q |
|
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
217349 |
taggggaggtttcatctttgtacttgacaccattccacgtgtatgtcattgtgtgcatgtcaaattgggtaatatagcaatatttatggtggataacact |
217250 |
T |
 |
Q |
163 |
atgtcattgtattgtattgcttattgtcatggttttataagctttggttagtccatggtacaacttct |
230 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
217249 |
atgtcattgt-----attgcttattgtcatggttttataagctttggttagtccatggtacaacttct |
217187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 542 times since January 2019
Visitors: 6717