View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0917_low_45 (Length: 301)
Name: NF0917_low_45
Description: NF0917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0917_low_45 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 99; Significance: 7e-49; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 83 - 189
Target Start/End: Original strand, 28624431 - 28624537
Alignment:
Q |
83 |
tactccctaacacacagatttgtttcaccaaagcacatctcaattcacatgccacctagctaatgtactaactggccctccagtgaaagaagatgcaata |
182 |
Q |
|
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
28624431 |
tactccctaacacacagatttgttccaccaaagcacatctcaattcacatgccacctagctaatgtactaactggcccttcagtgaaagaagatgcaata |
28624530 |
T |
 |
Q |
183 |
tagttcc |
189 |
Q |
|
|
||||||| |
|
|
T |
28624531 |
tagttcc |
28624537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 78 - 142
Target Start/End: Complemental strand, 2584084 - 2584020
Alignment:
Q |
78 |
gattatactccctaacacacagatttgtttcaccaaagcacatctcaattcacatgccacctagc |
142 |
Q |
|
|
|||| |||||||| |||||||||| |||||||||||||||||||||||||||||| |||||||| |
|
|
T |
2584084 |
gattctactccctgacacacagatcggtttcaccaaagcacatctcaattcacatgtcacctagc |
2584020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 139 - 189
Target Start/End: Complemental strand, 2584002 - 2583952
Alignment:
Q |
139 |
tagctaatgtactaactggccctccagtgaaagaagatgcaatatagttcc |
189 |
Q |
|
|
||||| ||||||||||| ||||| |||||| ||||||||||||||||||| |
|
|
T |
2584002 |
tagcttatgtactaactagcccttgagtgaatgaagatgcaatatagttcc |
2583952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 78 - 139
Target Start/End: Original strand, 11981855 - 11981916
Alignment:
Q |
78 |
gattatactccctaacacacagatttgtttcaccaaagcacatctcaattcacatgccacct |
139 |
Q |
|
|
|||| ||||||| |||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
11981855 |
gattctactccccgacacacagatcggtttcaccaaagcacatctcaattcacatgccacct |
11981916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 78 - 139
Target Start/End: Complemental strand, 18770756 - 18770695
Alignment:
Q |
78 |
gattatactccctaacacacagatttgtttcaccaaagcacatctcaattcacatgccacct |
139 |
Q |
|
|
|||| ||||||| |||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
18770756 |
gattctactccccgacacacagatcggtttcaccaaagcacatctcaattcacatgccacct |
18770695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University