View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0917_low_48 (Length: 296)
Name: NF0917_low_48
Description: NF0917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0917_low_48 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 53 - 254
Target Start/End: Original strand, 39194686 - 39194887
Alignment:
| Q |
53 |
cataggcaagagggttacatatataaactttggaaagtctgtatgtattttaacgaacatgtgagtgagggcccaaaagctggttcttgcctttatacta |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39194686 |
cataggcaagagggttacatatataaactttggaaagtctgtatgtattttaacgaacatgtgagtgagggcccaaaagctggttcttgcctttatacta |
39194785 |
T |
|
| Q |
153 |
cgtttgtttgtggttgctatccctttcaactttcatgccttaactttttagggtcatctatcttaatttctgtacaaagctgcatcttgactctgcttca |
252 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39194786 |
cgtttgtttgtggttgctatctctttcaactttcatgccttaactttttagggtcatctatcttaatttctgtacaaagctgcatcttgactctgcttca |
39194885 |
T |
|
| Q |
253 |
tg |
254 |
Q |
| |
|
|| |
|
|
| T |
39194886 |
tg |
39194887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 215 times since January 2019
Visitors: 6713