View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0917_low_49 (Length: 294)
Name: NF0917_low_49
Description: NF0917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0917_low_49 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 96 - 160
Target Start/End: Original strand, 11152075 - 11152139
Alignment:
| Q |
96 |
accatatgaaacaacgcatgtgaaacattgattaaacaatgtagtacaaatattgataggttata |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
11152075 |
accatatgaaacaacgcatgtgaaacattgattaagcaatgtagtacaaatattgataggttata |
11152139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 225 - 267
Target Start/End: Original strand, 11152204 - 11152246
Alignment:
| Q |
225 |
tactggatagccctagcacctctactaccccataccatgccta |
267 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
11152204 |
tactgggtagccctagcacctctactaccccataccatgccta |
11152246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University